schematic representation of a graphene and b graphene oxide structures
Synthesis of metal oxide nanostructures and their applications as lithium ion battery anodes
... much larger than that of < /b> currently commercially available graphite anode materials (372 mAh g-1), making SnO2 a < /b> very attractive candidate for LIB anode application 1.3.3 IRON OXIDES AS ANODE MATERIALS ... is considered as a < /b> major factor in undesirable global climate changes Lithium ion batteries (LIBs), as a < /b> type of < /b> secondary battery (rechargeable battery), have attracted tremendous attention during ... nano-sized metal oxide particles, the rate capability of < /b> anode can be enhanced Besides, nanosized metal oxides particles are also reported to be able to better accommodate the strain generated by volume...
- 188
- 1,022
- 0
Báo cáo khoa học: Identification and functional expression of a second human b-galactoside a2,6-sialyltransferase, ST6Gal II docx
... NeuAca2-3Galb1-3GalNAca1-O-Ser/Thrc NeuAca2-3Galb1-3[Neu5Aca2-6]GalNAca1-O-Ser/Thrc NeuAca2-6(3)Galb1-4GlcNAc-Rc Galb1-3GalNAca1-O-Ser/Thr Galb1-4GlcNAc-R Gala1-O-pNp GalNAca1-O-pNp GlcNAca1-O-pNp Galb1-4GlcNAcb-O-octyl ... Galb1-4GlcNAcb-O-octyl Galb1-3GlcNAcb-O-octyl Galb1-3GalNAca1-O-bn Galb1-4GlcNAc Galb1-3GlcNAc LNnT: Galb1-4GlcNAcb1-3Galb1-4Glc LNT: Galb1-3GlcNAcb1-3Galb1-4Glc 100 (0.52 )b 0 100 (13.86 )b 1.4 Asialofetuin Arylglycosides ... gland, caudate nucleus, temporal lobe, hippocampus, and < /b> fetal tissues (brain, kidney, thymus, liver), and < /b> rather weakly in placenta, lung, aorta, amygdala, occipital and < /b> parietal lobe and < /b> salivary...
- 12
- 584
- 0
Báo cáo khoa học: "High grade B-cell gastric lymphoma with complete pathologic remission after eradication of helicobacter pylori infection: Report of a case and review of the literature" pdf
... stomach, and < /b> a < /b> clinical stage E I2 was established We selected all cases reported with primary gastric large Bcell lymphoma treated with anti HP treatment and < /b> all cases of < /b> primary gastric large B- cell ... enrolled by Chen et al., [7] and < /b> Hiyama et al., [16] are a < /b> well defined subgroup characterized by clinical stage E I and < /b> presence of < /b> areas of < /b> MALT lymphoma; clinical stage is not clear in patients ... regression of < /b> lymphoma after chemotherapy [15,22] Because of < /b> the advanced age, additional chemotherapy was postponed in a < /b> patient; "wait and < /b> watch" follow-up was chosen for him [15] Page of < /b> (page number...
- 7
- 373
- 0
Báo cáo y học: " Identification of a novel linear B-cell epitope in the UL26 and UL26.5 proteins of Duck Enteritis Virus" doc
... TGCAGGGATCCATGCAGTTAGATGGTGACAAT CTTTGGTCGACTTATTCCCCCGGATAATAGAT 1540-1575 36 F7 TGCAGGGATCCATGTTAGATGGTGACAATATC CTTTGGTCGACTTATTCCCCCGGATAATAGAT 1543-1575 33 F8 TGCAGGGATCCATGGATGGTGACAATATCTAT ... CTTTGGTCGACTTATTCCCCCGGATAATAGAT 1552-1575 24 F11 TGCAGGGATCCATGAATATCTATTATCCGGGG CTTTGGTCGACTTATTCCCCCGGATAATAGAT 1555-1575 21 F12 F13 TGCAGGGATCCATGATCTATTATCCGGGGGAA CTTTGGTCGACTTATTCCCCCGGATAATAGAT GATCCATGATCTATTATCCGGGGTAAG ... GTCGACTTACAGCTGCCCTCCCTGGAC 1042-1347 306 F2 GGATCCATGTATGGACAGCCTGTTTAT GTCGACTTAAGCTAATGGTCCAGTAGA 1294-1731 438 F3 GGATCCATGCCTACTGGACAAGGTAAC GTCGACTCAACATCTATTACACATCA 1681-2124 444 F2-1 GGATCCATGTATGGACAGCCTGTTTAT...
- 9
- 450
- 0
Tài liệu Báo cáo khoa học: The role of the ESSS protein in the assembly of a functional and stable mammalian mitochondrial complex I (NADH-ubiquinone oxidoreductase) pptx
... were as follows: anti-porin from Calbiochem, anti-HA from Covance BabCo, anti-mouse and < /b> anti-rabbit secondary antibodies from Bio-Rad Laboratories and < /b> Amersham Pharmacia Biotech, respectively Antibodies ... designated as the mitochondrial fraction Immunochemical assays and < /b> antibodies Mitochondrial protein samples (between 50 and < /b> 100 lg) were separated by SDS/PAGE and < /b> BN/PAGE and < /b> transferred to Immobilon-P ... of < /b> the integral membranesubcomplex also assemble via the formation of < /b> distinct and < /b> identifiable assembly intermediates The mutants promise to be valuable tools in the elucidation of < /b> the assembly...
- 9
- 622
- 0
Báo cáo khoa học: Synthesis and characterization of a new and radiolabeled high-affinity substrate for H+/peptide cotransporters pdf
... Gly-Sar, Ala-Ala, Lys-Lys, Ala-Asp, d-Phe-Ala, Ala-Ala-Ala, d-aminolevulinic acid, cefadroxil and < /b> Ala-4-nitroanilide (all 100 lm, Table 1) Glycine, which is not a < /b> substrate of < /b> peptide transporters, ... as means ± standard error, n ¼ Lys[Z(NO2)]-Val, Lys(4-nitrobenzyloxycarbonyl)-Val Compound Bip-[3H]Pro uptake (%) Control Gly Gly-Sar Bip-Pro Ala-Ala Pro-Ala Lys-Lys Ala-Asp D-Phe-Ala Ala-Ala-Ala ... UK) Dexamethasone, apotransferrin, Gly-Gln, AlaAla, Ala-Ala-Ala, Lys-Lys, d-aminolevulinic acid, cefadroxil, Gly, Pro-Ala, 8-aminooctanoic acid and < /b> Gly-Sar were from Sigma-Aldrich (Deisenhofen,...
- 10
- 490
- 0
Báo cáo khoa học: Pulchellin, a highly toxic type 2 ribosome-inactivating protein from Abrus pulchellus Cloning, heterologous expression of A-chain and structural studies ppt
... degeneration at their 3Â ending A < /b> pair of < /b> degenerate primers (abrin 1: 5Â-ACTGAAGGTGCC ACTTCACAAAGCTAYAARCARTT-3Â; abrin 3: 5Â-GGT TAAACACTTCCCGTTGGACCTDATNGT-3Â) was chosen to represent the possible ... the far-UV CD spectra of < /b> rPAC, rPBC, rPAB and < /b> native pulchellin CD analyses for the rPAC sample showed a < /b> protein prole with predominance of < /b> a-< /b> helical elements [37]: two negative bands at 222 and < /b> ... Xa protease was purchased from Biolabs (Beverly, MA, USA) All other chemicals used were analytical grade Plant material and < /b> nucleic acid isolation from A < /b> pulchellus A < /b> pulchellus tenuiorus subspecies...
- 10
- 390
- 0
Báo cáo khoa học: Engineering of a monomeric and low-glycosylated form of human butyrylcholinesterase pdf
... kDa molecular mass range In contrast, the puri®ed plasma BChE showed a < /b> faint band at 170 kDa (nonreducible dimer) and < /b> a < /b> major broad band at 85 kDa (monomer) under reducing conditions (Fig 2A)< /b> ... the catalytic properties of < /b> the recombinant enzyme can be considered to be the same as the plasma enzyme SDS/PAGE analysis of < /b> the puri®ed recombinant BChE monomer displayed a < /b> single broad band ... Harel, M., Giles, K., Toker, L., Velan, B. , Lazar, A.< /b> , Kronman, C., Barak, D., Ariel, N., Shaerman, A.< /b> , Silman, I & Sussman, J.L (2000) Structures of < /b> recombinant native and < /b> E202Q mutant human...
- 8
- 472
- 0
Báo cáo khoa học: Membrane targeting of a folded and cofactor-containing protein potx
... 5¢-CATCACTTTGACAGCGTCTTTCTTGCTC TTGCTGATTGGCTTATCG-3¢ and < /b> 5¢-CGATAAGCCA ATCAGCAAGAGCAAGAAAGACGCTGTCAAAGTG ATG-3¢ using the QuikChange kit (Stratagene) with pCVH1 as a < /b> template The RRfiKK exchanges were confirmed by sequencing ... 5¢-AAGAGC AAGAAAGACGCTGTCAAAGTGATG-3¢/5¢-TCCGG ATATAGTTCCTCCT-3¢ and < /b> 5¢-ACGTTACTGGTTTC ACATTC-3¢/5¢-AGCGTCTTTCTTGCTCTTGCTGATT GGCTT-3¢ to generate two overlapping PCR fragments with pEXH5 as ... 55Fe accumulation was monitored The data indicated that only a < /b> small amount of < /b> 55Fe could be associated with the membrane in the absence of < /b> ATP, and < /b> addition of < /b> ATP enhanced it by about 5- to...
- 11
- 419
- 0
Báo cáo Y học: The reactivity of a-hydroxyhaem and verdohaem bound to haem oxygenase-1 to dioxygen and sodium dithionite pdf
... decreases in absorbance at 400, 535 and < /b> 690 nm took place and < /b> broad bands appeared at 431 and < /b> 795 nm (Fig 4A,< /b> spectrum a)< /b> The absorption around 795 nm initially increased and < /b> then decreased during ... brown-colored particles In Fig 2A,< /b> a < /b> slight decrease in absorbance between 300 and < /b> 600 nm (compare spectra a < /b> and < /b> b) was probably due to the precipitation of < /b> free a-< /b> hydroxyhaem These observations indicated ... exposure to air caused a < /b> loss of < /b> the absorption maxima at 340, 409 and < /b> 638 nm, and < /b> subsequent increases in the absorbances around 380 and < /b> 680 nm (Fig 5C, spectrum c) indicative of < /b> biliverdin formation...
- 9
- 501
- 0
Pulmonary tuberculosis associated with increased number and percentage of natural killer and B cells in the peripheral blood pot
... 252-260 Vidyarani M, SelvarajP, Jawahar MS, Rajeswari ND, Anbalagan S, Narayanan PR (2007) Intracellular granzyme A < /b> expression of < /b> peripheral blood lymphocyte subsets in pulmonary tuberculosis ... a < /b> Becton Dickinson FACScalibur instrument CELLQUEST TM software (BD Bioscience, San Jose, CA, USA) provided by the manufacturer was used for data acquisition and < /b> analysis Study Population Laboratory ... S.d = standard deviation, * = statistically significant Table Comparison of < /b> absolute numbers of < /b> peripheral blood lymphocyte subsets in patients with pulmonary tuberculosis and < /b> normal healthy individuals...
- 5
- 419
- 0
Báo cáo khoa học: Characterization of the lipopolysaccharide and b-glucan of the fish pathogen Francisella victoria ppt
... alanine, 3-aminobutyric acid (homoalanine or BABA), and < /b> a < /b> novel branched amino acid designated AA HMBC correlations allowed us to trace the BABA-acylated alanine, which was in turn linked to N-4 of < /b> terminal ... carbons, two of < /b> them protonated (59.4 and < /b> 66.5 p.p.m.) and < /b> one quaternary carbon at 79.0 p.p.m Proton signals at 4.23 and < /b> 4.73 p.p.m correlated with a < /b> quaternary carbon atom and < /b> carbonyl carbon ... intense band of < /b> the core-lipid A < /b> component (Fig 1) An additional diffuse band of < /b> higher molecular mass components was visible at high sample load Immunostaining using rabbit polyclonal antisera raised...
- 12
- 397
- 0
báo cáo hóa học: " Comparison of the discriminative ability of a generic and a condition-specific OHRQoL measure in adolescents with and without normative need for orthodontic treatment" potx
... related to the participant's oral impact In other words, occlusal traits that affect dental appearance and < /b> have an impact on participants' daily lives may not be captured by IOTN In addition, DAI ... crossbite, crowding, impeded eruption, defects of < /b> cleft lip and < /b> palate as well as any craniofacial anomaly, Class II and < /b> Class III buccal occlusions, and < /b> hypodontia Only the highest scoring trait ... functional limitation, physical pain, psychological discomfort, physical disability, psychological disability, social disability and < /b> handicap Adolescents were asked to rate each of < /b> the 14 items on a...
- 6
- 594
- 0
báo cáo hóa học: " A randomised comparison of a four- and a five-point scale version of the Norwegian Function Assessment Scale" doc
... Table 3: Mean item-total correlation and < /b> Cronbach's alpha for domain scores in the NFAS-4 and < /b> the NFAS-5 (N = 3325) Cronbach's alphaa NFAS-4 NFAS-5 Mean item-total correlation NFAS-4 NFAS-5 Walking/standing ... consistency was assessed by item-total correlation and < /b> Cronbach's alpha Item-total correlation coefficients should meet 0.40 standard Cronbach's alpha was considered acceptable for group comparisons ... conceptually related domains of < /b> NFAS correlated higher than scores of < /b> unrelated domains (Table 4) The NFAS-5 produced the largest correlations between domains and < /b> between domains and < /b> total scores,...
- 9
- 489
- 0
Báo cáo hóa học: " Closing two doors of viral entry: Intramolecular combination of a coreceptor- and fusion inhibitor of HIV-1" docx
... Design and < /b> biochemical characterization of < /b> BFFI Design and < /b> biochemical characterization of < /b> BFFI A < /b> Schematic < /b> diagram of < /b> BFFI BFFI is composed of < /b> the CCR5mAb RO-Ab0630, with two covalently attached ... Mechanism of < /b> action for BFFI Mechanism of < /b> action for BFFI A < /b> BFFI (■) and < /b> CCR5mAb (❍) bind to CCR5 with similar affinity as determined by FACS analysis B Antiviral Potency of < /b> BFFI BFFI (ᮀ) has a < /b> ... mouse/human CCR5mAb light and < /b> heavy chains are assembled in similar ways Transient expression and < /b> purification of < /b> proteins IGF-IRmAb, IGF-IRmAb-FI, CCR5mAb and < /b> CCR5mAb-FI were expressed by transient...
- 10
- 341
- 0
Báo cáo hóa học: " On the maximum modulus of a polynomial and its polar derivative" potx
... Inequalities and < /b> Applications 2011, 2011:111 http://www.journalofinequalitiesandapplications.com/content/2011/1/111 Page of < /b> The above lemma is due to Chan and < /b> Malik [11] Lemma 2.4 If p(z) is a < /b> polynomial ... best possible and < /b> equality occurs if p(z) = (z - k)n with a < /b> ≥ k If we divide both sides of < /b> the above inequality in (1.10) by |a|< /b> and < /b> make |a|< /b> ® ∞, we obtain a < /b> result proved by Govil [8] Lemmas ... refinement of < /b> a < /b> theorem of < /b> Paul Turan concerning polynomials Math Ineq Appl 1, 231–238 (1998) Jain, VK: Generalization of < /b> an inequality involving maximum moduli of < /b> a < /b> polynomial and < /b> its polar derivative...
- 9
- 423
- 0
Báo cáo hóa học: "Research Article Design of a Versatile and Low Cost μVolt Level A to D Conversion System for Use in Medical Instrumentation Applicatio" pdf
... conventional sample and < /b> hold facility which, in the case of < /b> a < /b> hand-held instrument, allows for a < /b> “snapshot” of < /b> the data stream to be made manually at a < /b> time chosen by the operator Use of < /b> this additional ... total circuit and < /b> incidental noise is random with a < /b> worstcase peak to peak spread of < /b> 3.87 mV As the negative and < /b> positive excursions are relatively uniform about a < /b> mean, EURASIP Journal on Advances ... numbers plotted in Table readily reveal the improvement in reliability of < /b> data obtained after conversion For example, at a < /b> mV signal the level of < /b> uncertainty achievable from reading the buffer analogue...
- 6
- 391
- 0
Step by Step Drawing of a Simple and Funny Cartoon Monkey ppt
... area Add two little eyes above the oval Step - Body & Arms Draw two long skinny rectangles to form the arms At the eng of < /b> the arms draw an egg shape to make the form of < /b> the hands When drawing a < /b> ... Draw another larger circle that overlaps part of < /b> the head circle Add two half circles to the sides of < /b> the head to make ears Add an oval to the middle-lower part of < /b> the head to show the mouth area ... drawing a < /b> surface to stand on You can this either by adding a < /b> line under the feet of < /b> the character, or by drawing a < /b> shadow underneath him This places your character 'somewhere' rather than having it...
- 5
- 319
- 0
Báo cáo toán học: "Maximum Multiplicity of a Root of the Matching Polynomial of a Tree and Minimum Path Cover" pdf
... Theorem 3.1 (Gallai-Edmonds Structure Theorem) Let G be any graph and < /b> let D0 (G), A0< /b> (G) and < /b> C0 (G) be the 0-partition classes of < /b> G (i) (The Stability Lemma) Let u ∈ A0< /b> (G) be a < /b> 0-special vertex ... journal of < /b> combinatorics 16 (2009), #R81 For any root θ of < /b> µ(G, x), it was shown by Neumaier [6, Corollary 3.3] that the analogue of < /b> Gallai’s Lemma holds when G is a < /b> tree A < /b> different proof was given ... Annals Discrete Math 29, Northa Holland, Amsterdam (1986) [6] A < /b> Neumaier, The second largest eigenvalue of < /b> a < /b> tree, Linear Algebra Appl 48 (1982), 9–25 the electronic journal of < /b> combinatorics 16 (2009),...
- 12
- 287
- 0
Tìm thêm: khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25