schematic representation of a graphene and b graphene oxide structures

... much larger than that of < /b> currently commercially available graphite anode materials (372 mAh g-1), making SnO2 a < /b> very attractive candidate for LIB anode application 1.3.3 IRON OXIDES AS ANODE MATERIALS ... is considered as a < /b> major factor in undesirable global climate changes Lithium ion batteries (LIBs), as a < /b> type of < /b> secondary battery (rechargeable battery), have attracted tremendous attention during ... nano-sized metal oxide particles, the rate capability of < /b> anode can be enhanced Besides, nanosized metal oxides particles are also reported to be able to better accommodate the strain generated by volume...

Ngày tải lên: 10/09/2015, 09:30

... NeuAca2-3Galb1-3GalNAca1-O-Ser/Thrc NeuAca2-3Galb1-3[Neu5Aca2-6]GalNAca1-O-Ser/Thrc NeuAca2-6(3)Galb1-4GlcNAc-Rc Galb1-3GalNAca1-O-Ser/Thr Galb1-4GlcNAc-R Gala1-O-pNp GalNAca1-O-pNp GlcNAca1-O-pNp Galb1-4GlcNAcb-O-octyl ... Galb1-4GlcNAcb-O-octyl Galb1-3GlcNAcb-O-octyl Galb1-3GalNAca1-O-bn Galb1-4GlcNAc Galb1-3GlcNAc LNnT: Galb1-4GlcNAcb1-3Galb1-4Glc LNT: Galb1-3GlcNAcb1-3Galb1-4Glc 100 (0.52 )b 0 100 (13.86 )b 1.4 Asialofetuin Arylglycosides ... gland, caudate nucleus, temporal lobe, hippocampus, and < /b> fetal tissues (brain, kidney, thymus, liver), and < /b> rather weakly in placenta, lung, aorta, amygdala, occipital and < /b> parietal lobe and < /b> salivary...

Ngày tải lên: 08/03/2014, 08:20

... stomach, and < /b> a < /b> clinical stage E I2 was established We selected all cases reported with primary gastric large Bcell lymphoma treated with anti HP treatment and < /b> all cases of < /b> primary gastric large B- cell ... enrolled by Chen et al., [7] and < /b> Hiyama et al., [16] are a < /b> well defined subgroup characterized by clinical stage E I and < /b> presence of < /b> areas of < /b> MALT lymphoma; clinical stage is not clear in patients ... regression of < /b> lymphoma after chemotherapy [15,22] Because of < /b> the advanced age, additional chemotherapy was postponed in a < /b> patient; "wait and < /b> watch" follow-up was chosen for him [15] Page of < /b> (page number...

Ngày tải lên: 09/08/2014, 07:21

... TGCAGGGATCCATGCAGTTAGATGGTGACAAT CTTTGGTCGACTTATTCCCCCGGATAATAGAT 1540-1575 36 F7 TGCAGGGATCCATGTTAGATGGTGACAATATC CTTTGGTCGACTTATTCCCCCGGATAATAGAT 1543-1575 33 F8 TGCAGGGATCCATGGATGGTGACAATATCTAT ... CTTTGGTCGACTTATTCCCCCGGATAATAGAT 1552-1575 24 F11 TGCAGGGATCCATGAATATCTATTATCCGGGG CTTTGGTCGACTTATTCCCCCGGATAATAGAT 1555-1575 21 F12 F13 TGCAGGGATCCATGATCTATTATCCGGGGGAA CTTTGGTCGACTTATTCCCCCGGATAATAGAT GATCCATGATCTATTATCCGGGGTAAG ... GTCGACTTACAGCTGCCCTCCCTGGAC 1042-1347 306 F2 GGATCCATGTATGGACAGCCTGTTTAT GTCGACTTAAGCTAATGGTCCAGTAGA 1294-1731 438 F3 GGATCCATGCCTACTGGACAAGGTAAC GTCGACTCAACATCTATTACACATCA 1681-2124 444 F2-1 GGATCCATGTATGGACAGCCTGTTTAT...

Ngày tải lên: 12/08/2014, 01:21

... were as follows: anti-porin from Calbiochem, anti-HA from Covance BabCo, anti-mouse and < /b> anti-rabbit secondary antibodies from Bio-Rad Laboratories and < /b> Amersham Pharmacia Biotech, respectively Antibodies ... designated as the mitochondrial fraction Immunochemical assays and < /b> antibodies Mitochondrial protein samples (between 50 and < /b> 100 lg) were separated by SDS/PAGE and < /b> BN/PAGE and < /b> transferred to Immobilon-P ... of < /b> the integral membranesubcomplex also assemble via the formation of < /b> distinct and < /b> identifiable assembly intermediates The mutants promise to be valuable tools in the elucidation of < /b> the assembly...

Ngày tải lên: 19/02/2014, 16:20

Ngày tải lên: 05/03/2014, 14:20

... Gly-Sar, Ala-Ala, Lys-Lys, Ala-Asp, d-Phe-Ala, Ala-Ala-Ala, d-aminolevulinic acid, cefadroxil and < /b> Ala-4-nitroanilide (all 100 lm, Table 1) Glycine, which is not a < /b> substrate of < /b> peptide transporters, ... as means ± standard error, n ¼ Lys[Z(NO2)]-Val, Lys(4-nitrobenzyloxycarbonyl)-Val Compound Bip-[3H]Pro uptake (%) Control Gly Gly-Sar Bip-Pro Ala-Ala Pro-Ala Lys-Lys Ala-Asp D-Phe-Ala Ala-Ala-Ala ... UK) Dexamethasone, apotransferrin, Gly-Gln, AlaAla, Ala-Ala-Ala, Lys-Lys, d-aminolevulinic acid, cefadroxil, Gly, Pro-Ala, 8-aminooctanoic acid and < /b> Gly-Sar were from Sigma-Aldrich (Deisenhofen,...

Ngày tải lên: 07/03/2014, 05:20

... degeneration at their 3Â ending A < /b> pair of < /b> degenerate primers (abrin 1: 5Â-ACTGAAGGTGCC ACTTCACAAAGCTAYAARCARTT-3Â; abrin 3: 5Â-GGT TAAACACTTCCCGTTGGACCTDATNGT-3Â) was chosen to represent the possible ... the far-UV CD spectra of < /b> rPAC, rPBC, rPAB and < /b> native pulchellin CD analyses for the rPAC sample showed a < /b> protein prole with predominance of < /b> a-< /b> helical elements [37]: two negative bands at 222 and < /b> ... Xa protease was purchased from Biolabs (Beverly, MA, USA) All other chemicals used were analytical grade Plant material and < /b> nucleic acid isolation from A < /b> pulchellus A < /b> pulchellus tenuiorus subspecies...

Ngày tải lên: 07/03/2014, 16:20

... kDa molecular mass range In contrast, the puri®ed plasma BChE showed a < /b> faint band at 170 kDa (nonreducible dimer) and < /b> a < /b> major broad band at 85 kDa (monomer) under reducing conditions (Fig 2A)< /b> ... the catalytic properties of < /b> the recombinant enzyme can be considered to be the same as the plasma enzyme SDS/PAGE analysis of < /b> the puri®ed recombinant BChE monomer displayed a < /b> single broad band ... Harel, M., Giles, K., Toker, L., Velan, B. , Lazar, A.< /b> , Kronman, C., Barak, D., Ariel, N., Sha€erman, A.< /b> , Silman, I & Sussman, J.L (2000) Structures of < /b> recombinant native and < /b> E202Q mutant human...

Ngày tải lên: 17/03/2014, 11:20

... 5¢-CATCACTTTGACAGCGTCTTTCTTGCTC TTGCTGATTGGCTTATCG-3¢ and < /b> 5¢-CGATAAGCCA ATCAGCAAGAGCAAGAAAGACGCTGTCAAAGTG ATG-3¢ using the QuikChange kit (Stratagene) with pCVH1 as a < /b> template The RRfiKK exchanges were confirmed by sequencing ... 5¢-AAGAGC AAGAAAGACGCTGTCAAAGTGATG-3¢/5¢-TCCGG ATATAGTTCCTCCT-3¢ and < /b> 5¢-ACGTTACTGGTTTC ACATTC-3¢/5¢-AGCGTCTTTCTTGCTCTTGCTGATT GGCTT-3¢ to generate two overlapping PCR fragments with pEXH5 as ... 55Fe accumulation was monitored The data indicated that only a < /b> small amount of < /b> 55Fe could be associated with the membrane in the absence of < /b> ATP, and < /b> addition of < /b> ATP enhanced it by about 5- to...

Ngày tải lên: 23/03/2014, 21:20

... decreases in absorbance at 400, 535 and < /b> 690 nm took place and < /b> broad bands appeared at 431 and < /b> 795 nm (Fig 4A,< /b> spectrum a)< /b> The absorption around 795 nm initially increased and < /b> then decreased during ... brown-colored particles In Fig 2A,< /b> a < /b> slight decrease in absorbance between 300 and < /b> 600 nm (compare spectra a < /b> and < /b> b) was probably due to the precipitation of < /b> free a-< /b> hydroxyhaem These observations indicated ... exposure to air caused a < /b> loss of < /b> the absorption maxima at 340, 409 and < /b> 638 nm, and < /b> subsequent increases in the absorbances around 380 and < /b> 680 nm (Fig 5C, spectrum c) indicative of < /b> biliverdin formation...

Ngày tải lên: 23/03/2014, 21:20

... 252-260 Vidyarani M, SelvarajP, Jawahar MS, Rajeswari ND, Anbalagan S, Narayanan PR (2007) Intracellular granzyme A < /b> expression of < /b> peripheral blood lymphocyte subsets in pulmonary tuberculosis ... a < /b> Becton Dickinson FACScalibur instrument CELLQUEST TM software (BD Bioscience, San Jose, CA, USA) provided by the manufacturer was used for data acquisition and < /b> analysis Study Population Laboratory ... S.d = standard deviation, * = statistically significant Table Comparison of < /b> absolute numbers of < /b> peripheral blood lymphocyte subsets in patients with pulmonary tuberculosis and < /b> normal healthy individuals...

Ngày tải lên: 29/03/2014, 03:20

... alanine, 3-aminobutyric acid (homoalanine or BABA), and < /b> a < /b> novel branched amino acid designated AA HMBC correlations allowed us to trace the BABA-acylated alanine, which was in turn linked to N-4 of < /b> terminal ... carbons, two of < /b> them protonated (59.4 and < /b> 66.5 p.p.m.) and < /b> one quaternary carbon at 79.0 p.p.m Proton signals at 4.23 and < /b> 4.73 p.p.m correlated with a < /b> quaternary carbon atom and < /b> carbonyl carbon ... intense band of < /b> the core-lipid A < /b> component (Fig 1) An additional diffuse band of < /b> higher molecular mass components was visible at high sample load Immunostaining using rabbit polyclonal antisera raised...

Ngày tải lên: 30/03/2014, 10:20

... related to the participant's oral impact In other words, occlusal traits that affect dental appearance and < /b> have an impact on participants' daily lives may not be captured by IOTN In addition, DAI ... crossbite, crowding, impeded eruption, defects of < /b> cleft lip and < /b> palate as well as any craniofacial anomaly, Class II and < /b> Class III buccal occlusions, and < /b> hypodontia Only the highest scoring trait ... functional limitation, physical pain, psychological discomfort, physical disability, psychological disability, social disability and < /b> handicap Adolescents were asked to rate each of < /b> the 14 items on a...

Ngày tải lên: 18/06/2014, 19:20

... Table 3: Mean item-total correlation and < /b> Cronbach's alpha for domain scores in the NFAS-4 and < /b> the NFAS-5 (N = 3325) Cronbach's alphaa NFAS-4 NFAS-5 Mean item-total correlation NFAS-4 NFAS-5 Walking/standing ... consistency was assessed by item-total correlation and < /b> Cronbach's alpha Item-total correlation coefficients should meet 0.40 standard Cronbach's alpha was considered acceptable for group comparisons ... conceptually related domains of < /b> NFAS correlated higher than scores of < /b> unrelated domains (Table 4) The NFAS-5 produced the largest correlations between domains and < /b> between domains and < /b> total scores,...

Ngày tải lên: 18/06/2014, 22:20

... Design and < /b> biochemical characterization of < /b> BFFI Design and < /b> biochemical characterization of < /b> BFFI A < /b> Schematic < /b> diagram of < /b> BFFI BFFI is composed of < /b> the CCR5mAb RO-Ab0630, with two covalently attached ... Mechanism of < /b> action for BFFI Mechanism of < /b> action for BFFI A < /b> BFFI (■) and < /b> CCR5mAb (❍) bind to CCR5 with similar affinity as determined by FACS analysis B Antiviral Potency of < /b> BFFI BFFI (ᮀ) has a < /b> ... mouse/human CCR5mAb light and < /b> heavy chains are assembled in similar ways Transient expression and < /b> purification of < /b> proteins IGF-IRmAb, IGF-IRmAb-FI, CCR5mAb and < /b> CCR5mAb-FI were expressed by transient...

Ngày tải lên: 20/06/2014, 01:20

... Inequalities and < /b> Applications 2011, 2011:111 http://www.journalofinequalitiesandapplications.com/content/2011/1/111 Page of < /b> The above lemma is due to Chan and < /b> Malik [11] Lemma 2.4 If p(z) is a < /b> polynomial ... best possible and < /b> equality occurs if p(z) = (z - k)n with a < /b> ≥ k If we divide both sides of < /b> the above inequality in (1.10) by |a|< /b> and < /b> make |a|< /b> ® ∞, we obtain a < /b> result proved by Govil [8] Lemmas ... refinement of < /b> a < /b> theorem of < /b> Paul Turan concerning polynomials Math Ineq Appl 1, 231–238 (1998) Jain, VK: Generalization of < /b> an inequality involving maximum moduli of < /b> a < /b> polynomial and < /b> its polar derivative...

Ngày tải lên: 20/06/2014, 22:20

... conventional sample and < /b> hold facility which, in the case of < /b> a < /b> hand-held instrument, allows for a < /b> “snapshot” of < /b> the data stream to be made manually at a < /b> time chosen by the operator Use of < /b> this additional ... total circuit and < /b> incidental noise is random with a < /b> worstcase peak to peak spread of < /b> 3.87 mV As the negative and < /b> positive excursions are relatively uniform about a < /b> mean, EURASIP Journal on Advances ... numbers plotted in Table readily reveal the improvement in reliability of < /b> data obtained after conversion For example, at a < /b> mV signal the level of < /b> uncertainty achievable from reading the buffer analogue...

Ngày tải lên: 22/06/2014, 01:20

... area Add two little eyes above the oval Step - Body & Arms Draw two long skinny rectangles to form the arms At the eng of < /b> the arms draw an egg shape to make the form of < /b> the hands When drawing a < /b> ... Draw another larger circle that overlaps part of < /b> the head circle Add two half circles to the sides of < /b> the head to make ears Add an oval to the middle-lower part of < /b> the head to show the mouth area ... drawing a < /b> surface to stand on You can this either by adding a < /b> line under the feet of < /b> the character, or by drawing a < /b> shadow underneath him This places your character 'somewhere' rather than having it...

Ngày tải lên: 28/06/2014, 18:20

... Theorem 3.1 (Gallai-Edmonds Structure Theorem) Let G be any graph and < /b> let D0 (G), A0< /b> (G) and < /b> C0 (G) be the 0-partition classes of < /b> G (i) (The Stability Lemma) Let u ∈ A0< /b> (G) be a < /b> 0-special vertex ... journal of < /b> combinatorics 16 (2009), #R81 For any root θ of < /b> µ(G, x), it was shown by Neumaier [6, Corollary 3.3] that the analogue of < /b> Gallai’s Lemma holds when G is a < /b> tree A < /b> different proof was given ... Annals Discrete Math 29, Northa Holland, Amsterdam (1986) [6] A < /b> Neumaier, The second largest eigenvalue of < /b> a < /b> tree, Linear Algebra Appl 48 (1982), 9–25 the electronic journal of < /b> combinatorics 16 (2009),...

Ngày tải lên: 07/08/2014, 21:21