running silverlight 3 on a mac
Báo cáo Y học: Variations in receptor site-3 on rat brain and insect sodium channels highlighted by binding of a funnel-web spider d-atracotoxin pdf
... quantification was performed using a bicinchoninic acid Protein Assay Kit (Pierce) using BSA as a standard Absorbance was read at 570 nm on a BIO-RAD Model 450 microplate reader The molecular mass ... same amount of membranes Data were analysed using the iterative program LIGAND (Elsevier Biosoft) using Ôcold saturationÕ or Ôhot saturationÕ analysis The kinetic data for ligand association and ... conditions may be related to the 48-fold decrease in its association rate constant (Table 1) Thus, the conformational alteration induced by depolarization at receptor site -3 appears to affect toxin...
Ngày tải lên: 08/03/2014, 16:20
The Design and Implementation of a Java Virtual Machine on a Cluster of Workstations pptx
Ngày tải lên: 23/03/2014, 22:21
Báo cáo Y học: A new high affinity binding site for suppressor of cytokine signaling-3 on the erythropoietin receptor potx
... ACTGAGCAGCGCGTTCGCCTCGCCGCCGGTC -3 (L5 8A as), 85¢-CAGTCTGGGACCAAGAACGCGCGC ATCCAGTGTGAGGGG -3 (L9 3A s), 5¢-CCCCTCACA CTGGATGCGCGCGTTCTTGGTCCCAGACTG -3 (L9 3A as), 5¢-GTCTGGGACCAAGAACCTGGAAAT CCAGTGTGAGGGGGGCAGC -3 ... 5¢-CTACTGGAGCGCAGTGACCGTCGGCGAGGCG AACCTGCTGC -3 (G53V s), 5¢-GCAGCAGGTTCGCC TCGCCGACGGTCACTGCGCTCCAGTAG -3 (G53V as), 5¢-GACCGGCGGCGAGGCGAACGCGCTGCTC AGTGCCGAGCCCG -3 (L5 8A s), 5¢-CGGGCTCGGC ACTGAGCAGCGCGTTCGCCTCGCCGCCGGTC -3 ... this case the exact Kd value was not assessed by Scatchard analysis because the highest SOCS -3 concentration was 30 lM and a calculation by the BIAEVALUATION software 2522 M Hortner et al (Eur...
Ngày tải lên: 24/03/2014, 00:21
Báo cáo khoa học: "A Statistical Machine Translation Model Based on a Synthetic Synchronous Grammar" docx
... Chiang 2007 Hierarchical phrase-based translation In computational linguistics, 33 (2) Jason Eisner 20 03 Learning non-isomorphic tree mappings for machine translation In Proceedings of ACL 20 03 ... (Zhang et al., 2008) in our current implementation 2.2 The SSG-based Translation Model The translation in our SSG-based translation model can be treated as a SSG derivation A derivation consists ... of a sequence of grammar rule applications To model the derivations as a latent variable, we define the conditional probability distribution over the target translation e and the cor- This relates...
Ngày tải lên: 31/03/2014, 00:20
Báo cáo sinh học: "Bisphosphonate-associated osteonecrosis of the jaw is linked to suppressed TGFb1-signaling and increased Galectin-3 expression: A histological study on biopsies" pot
... dilution 1:100) Smad-2 /3 was detected with a polyclonal goat-IgG (anti-human Smad-2 /3, sc-6 033 , Santa Cruz, USA; dilution: 1:100) Smad-7 was detected with a polyclonal goat-anti-human antibody ... TGFb1 and Galectin -3 in cellular differentiation, tissue regeneration, and inflammation may be relevant to the mechanisms underlying BRONJ The American Society for Bone and Mineral Research has ... indicated significantly increased cellular Smad-2 /3 expression (p < 0.0 43) Analysis of Smad-7 expression Figure A histopathologic section of a BRONJ-affected jaw (hematoxylin-staining, original magnification...
Ngày tải lên: 18/06/2014, 19:20
Báo cáo hóa học: " Research Article Static Object Detection Based on a Dual Background Model and a Finite-State Machine Rub´ n Heras Evangelio and Thomas Sikora e" doc
... fashion some additional specialized states can be defined Figure also shows six additional conditions on six transitions marked as an orange point on the respective transition arrows The reason ... modelled as a mixture of a maximum number N of Gaussians Each Gaussian distribution i is characterized by an estimated mixing weight ωi , a mean value, and a variance The Gaussian distributions are ... (states) and establish which transitions are allowed from each state and what are the inputs needed to cause these transitions In this way, we can define the state transitions of a finitestate machine,...
Ngày tải lên: 21/06/2014, 07:20
3.Storing Data on a Disk.ppt
... ÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿ Page 12 Sheet1 ÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿ Page 13 Sheet1 ÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿ ... ÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿ Page 22 Sheet1 ÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿ Page 23 Sheet1 ÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿ ... ÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿ Page Sheet1 ÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿ Page Sheet1 ÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿ...
Ngày tải lên: 16/07/2014, 01:00
Báo cáo khoa học:Bounds on the Tur´n density of PG(3, 2) a pot
... { 03, 0 23} , {0 13, 01 23} }, M(02) = { {3, 0 23} , { 03, 23} , { 13, 01 23} , {0 13, 1 23} }, M(12) = { {3, 1 23} , { 03, 01 23} , { 13, 23} , {0 13, 0 23} } and M(012) = { {3, 01 23} , { 03, 1 23} , { 13, 0 23} , { 23, 0 13} } Then ... as follows: M(0) = { {3, 03} , { 13, 0 13} , { 23, 0 23} , {1 23, 01 23} }, M(1) = { {3, 13} , { 03, 0 13} , { 23, 1 23} , {0 23, 01 23} } and M(2) = { {3, 23} , { 13, 1 23} , { 03, 0 23} , {0 13, 01 23} } We then continue as ... these matchings as follows: M(0) = { {3, 03} , { 13, 0 13} , { 23, 0 23} , {1 23, 01 23} }, M(1) = { {3, 13} , { 03, 0 13} , { 23, 1 23} , {0 23, 01 23} } and M(01) = { {3, 0 13} , { 03, 13} , { 23, 01 23} , {1 23, 0 23} } We...
Ngày tải lên: 07/08/2014, 08:20
Báo cáo khoa học:" The interaction between the measles virus nucleoprotein and the Interferon Regulator Factor 3 relies on a specific cellular environment" pdf
... elsewhere [36 ] The IFR -3 cDNA was PCR amplified using forward 5'-CATGAATTCATGGGAACCCCAAAGCCA -3' and backward 5'-TGACTCGAGTCAGCTCTCCCCAGGGCC -3' primers containing EcoRI and XhoI restriction sites ... –His-Ura-Trp + X-Gal PCT (B) AD-IRF3 (65 kDa) AD-PCT (58 kDa) IRF3 83 kDa 62 kDa 47.5 kDa Analysis IRF -3 and NTAIL interaction in yeast Figure of Analysis of IRF -3 and NTAIL interaction in yeast (A) ... best, assuming an IRF -3 intracellular concentration of approximately μM, as calculated assuming an overall intracellular protein concentration of 200 mg/ml and that IRF -3 represents approximately...
Ngày tải lên: 12/08/2014, 04:21
Learn Objective C on the Mac phần 3 ppt
... program hasn’t changed at all: I I I I I am am am am am an engine Vrooom! a tire I last a while a tire I last a while a tire I last a while a tire I last a while As with Shapes-Object, we’ve refactored ... pass in as a parameter For example, NSData (a Cocoa class for objects that store an arbitrary sequence of bytes) has a method called getBytes:, which takes a parameter that is the address of a memory ... AllWeatherRadial is a tire When you can say, “X is a Y,” you can use inheritance 85 86 CHAPTER 5: Composition Composition, on the other hand, sets up a “has a relationship A shape has a fill...
Ngày tải lên: 12/08/2014, 20:22
A particle swarm optimisation based grey prediction model for thermal error compensation on CNC machine tools
... Laser Metrology and Machine Performance XI A particle swarm optimisation-based Grey prediction model for thermal error compensation on CNC machine tools Ali M Abdulshahed, Andrew P Longstaff, ... Mian N, Fletcher S, Longstaff A and Myers A 20 13 Efficient estimation by FEA of machine tool distortion due to environmental temperature perturbations Precis Eng vol 37 p 37 2-79 Abdulshahed A, ... + �) Laser Metrology and Machine Performance XI 2.4 Grey relational analysis method Grey relational analysis (GRA) is a method to capture the correlations between the reference factor and other...
Ngày tải lên: 08/11/2015, 00:01
On a thermomechanical model of shear instability in machining
... Metals and Materials, 6: 531 (121Shaw, M C., and A Vyas, 19 93, Chip Formation in the Machining of Hardened Steel Annals of CIRP, 42/1: 29 -33 [ 13] Lemaire, J C and W A Backofen, Feb 1972, Adiabatic ... analytically the codtions for the onset of shear localization Based on an analysis of the shear localized chip formation process, three primary heat sources and reheating effects of these heat ... shear localization was found to be much lower for Titanium 6A1 4V (about m/min) than for AM 434 0 steel ( 130 m/min) Values of a' and were calculated for AlSl 434 0 steel over a ran e of practical cutting...
Ngày tải lên: 18/02/2016, 08:56
Ôn tập mạch IC
... VIL(max) 3, 5V 1,5V 3, 5V 1,0V 2,0V 0,8V VOH(min) VOL(max) 4,95V 0,05V 4,9V 0,1V 4,9V 0,1V IIH(max) IIL(max) 1 A 1 A 1 A 1 A 1 A 1 A IOH(max) IOL(max) 0,4 mA 0,4 mA mA mA mA mA 74 74L 74AS 74ALS ... 40 A 20μ 200 A 20 A 1,6 A mA 100 A mA 0,4 mA 0,4 0,4 mA 0,4 mA mA mA 20 mA mA 16 mA mA Bảng 4.4 Có thể nói điều kiện để thúc trực tiếp - Khi dòng điện tầng thúc lớn dòng điện vào tầng tải hai ... xung CK max (MHz) Fan Out (cùng loạt) Điện VOH(min) VOL (max) VIH (min), VIL (max) 10 90 35 10 33 33 20 23 138 50 10 20 60 125 20 9,5 19 45 20 1,7 13, 6 200 40 1,2 4,8 70 20 18 100 33 2,4 0,4...
Ngày tải lên: 18/09/2012, 10:13
Some studies on a probabilistic framework for finding object-oriented information in unstructured data
... the 22nd international conference on Machine learning [10] Eric Chu, Akanksha Baid, Ting Chen, An-Hai Doan, and Jeffrey F Naughton A relational approach to incrementally extracting and querying ... solution based on its approach with different advantages, however, they also have some shortcomings Information Extraction based solution has low scalability and low adaptability while Text Information ... HTML standard In addition, many new websites are added and old ones are deleted every day Thus, if a system can not adapt to change, it might get obsolete and not usable at all [ 13] 1 .3 Main contribution...
Ngày tải lên: 23/11/2012, 15:04
Apress - Learn Objective-C on the Mac (2009)
... desktop applications He’s also the principal author of Advanced Mac OS X Programming (Big Nerd Ranch 2005) In his spare time, he plays trombone and bassoon and makes balloon animals Scott Knaster ... 11:55 :35 .909 11:55 :35 .926 11:55 :35 .927 11:55 :35 .928 11:55 :35 . 935 11:55 :35 . 936 11:55 :35 . 936 11:55 :35 . 939 11:55 :35 . 939 11:55 :35 .940 11:55 :35 .940 03. 02 03. 02 03. 02 03. 02 03. 02 03. 02 03. 02 03. 02 03. 02 ... of frameworks Cocoa consists of a pair of frameworks, Foundation and Application Kit (also known as AppKit), along with a suite of supporting frameworks, including Core Animation and Core Image,...
Ngày tải lên: 07/12/2012, 15:47
The 25 most difficult questions you'll be asked on a job interviewThe 25 most difficult questions you'll be asked on a job interview
... For example, if the organization is known for strong management, your answer should mention that fact and show that you would like to be a part of that team If the company places a great deal of ... more at your age? Say that this is one reason that you are conducting this job search Don't be defensive 23 What you feel this position should pay? Salary is a delicate topic We suggest that you ... good manager? Can you give me some examples? WWW.RabElMagd.com WWW.RabElMagd.com Do you feel that you have top managerial potential? Keep your answer achievementand ask-oriented Rely on examples...
Ngày tải lên: 07/02/2013, 09:37
Bạn có muốn tìm thêm với từ khóa: