rice versus xanthomonas oryzae pv oryzae a unique pathosystem

Đánh giá tính kháng, nhiễm bệnh bạc lá (xanthomonas oryzae pv  oryzae) trên một số dòng lúa triển vọng

Đánh giá tính kháng, nhiễm bệnh bạc lá (xanthomonas oryzae pv oryzae) trên một số dòng lúa triển vọng

... họ gen avrBs1 chỉ tìm thấy ở Xanthomonas campestis pv. campestris, còn họ gen avrBs3/pth xuất hiện phổ biến ở loài Xanthomonas oryzae pv. oryzae [21]. Ở loài Xanthomonas axonopodis pv. citri ... l a trồng và l a hoang. Mười một trong số ñó là gen lặn bao gồm: xa5, xa5(t), xa8, xa13, xa15, xa19, xa20, xa24, xa28, xa31 và xa32. Có 6 gen ñã ñược tách dòng là: Xa1, xa5, xa13, Xa21 Xa26 ... IRBB54 (xa5+Xa21); IRBB55 (xa13+Xa21); - Bốn dòng mang 3 gen kháng là: IRBB59 (xa5+xa13+Xa21); IRBB61 (Xa4+xa5+Xa7); IRBB62 (Xa4+Xa7+Xa21); IRBB63 (xa5+Xa7+xa13); - Hai dòng mang 4 gen kháng...

Ngày tải lên: 22/11/2013, 15:41

84 1,2K 1
PHÂN LẬP VÀ NHẬN DIỆN VI KHUẨN GÂY BỆNH BẠC LÁ LÚA (XANTHOMONAS ORYZAE PV ORYZAE) BẰNG KỸ THUẬT PCR ĐA THÀNH PHẦN doc

PHÂN LẬP VÀ NHẬN DIỆN VI KHUẨN GÂY BỆNH BẠC LÁ LÚA (XANTHOMONAS ORYZAE PV ORYZAE) BẰNG KỸ THUẬT PCR ĐA THÀNH PHẦN doc

... Keywords: Isolation, multiplex PCR, specific primer, Xanthomonas oryzae pv. oryzae Title: Isolation and identification of bacteria caught bacterial leaf blight (Xanthomonas oryzae pv. oryzae ) by ... Xanthomonas oryzae pv. oryzae. The pair of primers XO290R-F was designed to amplify a 290bp fragment based on rhs gene family of Xanthomonas oryzae pv. oryzae because these genes are structurally ... A THÀNH PHẦN Nguyễn Thị Liên 1 , Trần Thị Xuân Mai 1 và Nguyễn Thị Pha 1 ABTRACT Bacterial leaf blight of rice, caused by Xanthomonas oryzae pv. oryzae, is a harmful disease of rice plants...

Ngày tải lên: 20/03/2014, 08:21

10 1,1K 4
Báo cáo khoa học: NMR and MS evidences for a random assembled O-specific chain structure in the LPS of the bacterium Xanthomonas campestris pv. Vitians A case of unsystematic biosynthetic polymerization potx

Báo cáo khoa học: NMR and MS evidences for a random assembled O-specific chain structure in the LPS of the bacterium Xanthomonas campestris pv. Vitians A case of unsystematic biosynthetic polymerization potx

... possible combinations: (B ¼ b-Rha, A ¼ a- Rha, A ¼ a- Fuc3NAc (1fi2) a- Rha) B A, B– A B A A, B A A, B A A, B A A B A A A, B A A A, B A A A, B A A A, B A A A, B– A A A, B A A A, B A A A Several of these ... modelled were A A B A A B A A, A A B A A B A A, A A B A AvB A A and A A B– A A B A A (B: b-Rhap ,A: a-Rhap, A: a- Fucp3NAc(1fi2 )a- Rhap). The phi and psi angles are defined by H1–C1–O1–CX and C1–O1–CX–HX, ... away towards the terminal end. The following fragments were assignable (the assigned a- Rha being bold): B A B A, B A B– A, B A A A, B A A A, B A A A/ B, A A A, A A B, A A B, B A B, B A A, B A A, ...

Ngày tải lên: 31/03/2014, 09:20

9 455 0
Tài liệu Báo cáo khoa học: Molecular and biochemical characterization ofD-phosphoglycerate dehydrogenase fromEntamoeba histolytica A unique enteric protozoan parasite that possesses both phosphorylated and nonphosphorylated serine metabolic pathways docx

Tài liệu Báo cáo khoa học: Molecular and biochemical characterization ofD-phosphoglycerate dehydrogenase fromEntamoeba histolytica A unique enteric protozoan parasite that possesses both phosphorylated and nonphosphorylated serine metabolic pathways docx

... to an open reading frame (ORF) of EhPGDH was amplified by PCR using a cDNA library [26] as a template, and oligonucleotide primers (5¢-caGGATCCaagatagttgtgataac cga-3¢ and 5¢-caCTCGAGttagaacttattgacttggaa-3¢), ... protozoan parasite Entamoeba histolytica. Mol. Biochem. Parasitol. 97, 33–44. 27. Nozaki, T., Asai, T., Sanchez, L.B., Kobayashi, S., Nakazawa, M. & Takeuchi, T. (1999) Characterization of ... methionine c-lyase from Entamoeba histolytica: a key enzyme of sulfur-amino acid degradation in an anaerobic parasitic protist that lacks forward and reverse transsulfuration pathways. J. Biol. Chem....

Ngày tải lên: 19/02/2014, 13:20

12 464 0
Tài liệu Báo cáo khoa học: A unique variant of streptococcal group O-antigen (C-polysaccharide) that lacks phosphocholine ppt

Tài liệu Báo cáo khoa học: A unique variant of streptococcal group O-antigen (C-polysaccharide) that lacks phosphocholine ppt

... clearly showed that the majority of the material constituted of a tetrasaccha- ride and a smaller amount of a tetrasaccharide-ribitol. The data shows that the AAT residue is indeed an acetamido-amino ... was clear that the oligosaccharide fraction was a mixture and that it was the same mixture as that obtained from pneumococcal C-polysaccharide when treated with aqueous 48% HF under same conditions. ... The phosphoethanolamine and phosphate groups were absent as a result of that all phosphate ester linkages were broken. From the 1 H-NMR spectrum it was clear that the fraction contained a major and a minor...

Ngày tải lên: 20/02/2014, 11:20

6 546 0
Báo cáo khoa học: A novel antifungal hevein-type peptide from Triticum kiharae seeds with a unique 10-cysteine motif doc

Báo cáo khoa học: A novel antifungal hevein-type peptide from Triticum kiharae seeds with a unique 10-cysteine motif doc

... CAGGCTCGTGGTGCTAAATGCCCGAACTGCCTGTGCTGTG 3f GTAAGTACGGCTTCTGCGGTTCTGGTGACGCTTACTGTGG 4f CGCTGGTTCTTGCCAGTCTCAGTGCCGTGGTTGCTAG GGAT 1r TTTAGCACCACGAGCCTGGTCACCGCAACGCTGAGC 2r CGCAGAAGCCGTACTTACCACAGCACAGGCAGTTCG 3r ... CGCAGAAGCCGTACTTACCACAGCACAGGCAGTTCG 3r GACTGGCAAGAACCAGCGCCACAGTAAGCGTCACCA Reverse GCTA GGATCCCTAGCAACCACGGCAC Table 2. Antifungal activity of WAMP- 1a. IC 50 is the concentration necessary for 50% growth inhibition. Fungi ... kiharae seeds with a unique 10-cysteine motif Tatyana I. Odintsova 1 , Alexander A. Vassilevski 2 , Anna A. Slavokhotova 1 , Alexander K. Musolyamov 2 , Ekaterina I. Finkina 2 , Natalia V. Khadeeva 1 ,...

Ngày tải lên: 07/03/2014, 02:20

10 505 0
Báo cáo khoa học: Characterization of the rice carotenoid cleavage dioxygenase 1 reveals a novel route for geranial biosynthesis ppt

Báo cáo khoa học: Characterization of the rice carotenoid cleavage dioxygenase 1 reveals a novel route for geranial biosynthesis ppt

... of carotenoids. Abbreviations CCD, carotenoid cleavage dioxygenase; GST, glutathione S-transferase; NIST, National Institute of Standards and Technology; OsCCD1, Oryza sativa carotenoid cleavage ... Dun EA, Pillot JP, Letisse F, Matusova R, Danoun S, Portais JC et al. (2008) Strigolactone inhibition of shoot branching. Nature 455, 189–194. 11 Umehara M, Hanada A, Yoshida S, Akiyama K, Arite T, ... 3-OH-c-car- otene and lycopene. The values represent ratios of the C 17 and C 19 dialdehydes in the sum of their peak areas calculated by integrating each peak at its individual k max . Data represent...

Ngày tải lên: 07/03/2014, 03:20

12 498 0
Báo cáo khoa học: Exo-mode of action of cellobiohydrolase Cel48C from Paenibacillus sp. BP-23 A unique type of cellulase among Bacillales ppt

Báo cáo khoa học: Exo-mode of action of cellobiohydrolase Cel48C from Paenibacillus sp. BP-23 A unique type of cellulase among Bacillales ppt

... molecular mass of 118 kDa and a pI of 4.85, displayed a multidomain organ- ization bearing a canonical family 48 catalytic domain, a bacterial type 3a cellulose-binding module, and a putative fibronectin-III ... cellulase among Bacillales Marta M. Sa ´ nchez, F. I. Javier Pastor and Pilar Diaz Department of Microbiology, Faculty of Biology, University of Barcelona, Spain Sequence analysis of a Paenibacillus ... domain. The cloned cellulase, unique among Bacillales and designated Cel48C, was purified through a nity chromatography using its ability to bind Avicel. Maximum activity was achieved at 45 °C and...

Ngày tải lên: 08/03/2014, 02:21

7 404 0
w