... 5¢-gatgagtcgggagTTTcag ctggagaaaaaag-3¢, 5¢-ggacccgttttgcgACCtcgaaagtgagc-3¢, and 5¢-ggacccgttttgcgTTTtcgaaagtgagc-3¢ Preparation of Ec DosH The (His)6-tagged Ec DosH proteins (wild-type and ... states of Leu mutants of Ec DOS N Yokota et al Sato A, Sasakura Y, Sugiyama S, Sagami I, Shimizu T, Mizutani Y & Kitagawa T (2002) Stationary and timeresolved resonance Raman spectra of His77 and ... whereas Ala and Asn substitutions at Asp40, an amino-acid residue that interacts via two water molecules with the proximal ligand His77, markedly increased the rate of auto-oxidation [13] (Table...
Ngày tải lên: 16/03/2014, 13:20
... States, the internationalization of accounting standards may lead to a change in the language of accounting • The growth of outsourcing and an upsurge in the offshoring of services and manufacturing ... CAE of a global defense and aerospace company that buys parts from around the world said that vendor quality and standards are of primary concern to all global companies She said that when she assesses ... impacting internal audit today and in the future As organizations expand to take advantage of global markets and supply chains, internal audit faces a burgeoning need for its services A majority...
Ngày tải lên: 23/03/2014, 04:20
Báo cáo khoa học: A possible physiological function and the tertiary structure of a 4-kDa peptide in legumes potx
... TyrA19 at the A- chain C-terminus, and ValB12 and TyrB16 at the B-chain central helix assume essentially the same spatial arrangements both in the locked, inactive state and in the unlocked state ... studies revealed that a small amount of 4-kDa peptide is localized around the plasma membranes and cell walls [9] The subcellular localization of 4-kDa peptide is similar to that of the 43-kDa protein, ... considered as the locked and inactive state, most of these residues form an extensive hydrophobic core at the interface between the B-chain b-strand and the B-chain central helix as well as the A- chain...
Ngày tải lên: 31/03/2014, 07:20
Báo cáo khoa học: " Risk Factors for High Endoparasitic Burden and the Efficiency of a Single Anthelmintic Treatment of Danish Horses" doc
... the aim of validating the questionnaire (Lendal et al 1998) Data analysis Initially bivariate analyses were performed, and variables having p-values below 0.15 were included in the multivariate ... between the logarithm of EPG pretreatment and EPG post-treatment) with standard errors (SE) and P-values from bivariate and multivariate analysis are listed Risk factors (levels) N Bivariate analysis ... estimation The confidence interval of the estimates was based on Wald’s statistics Efficiency of a single anthelmintic treatment The bivariate and the multivariate regression analyses were based...
Ngày tải lên: 12/08/2014, 15:20
RAMIFICATION OF THE GAUSS MAP AND THE TOTAL CURVATURE OF A COMPLETE MINIMAL SURFACE
... Jin and M Ru,Algebraic curves and the Gauss map of algebraic minimal surfaces, Differential Geom Appl., 25 (2007), 701-712 [12] Y Kawakami, R Kobayashi, and R Miyaoka, The Gauss map of pseudoalgebraic ... Dethloff and P H Ha, Ramification of the Gauss map of complete minimal surfaces in R3 and R4 on annular ends, Ann Fac Sci Toulouse Math., 23 (2014), 829-846 RAMIFICATION OF THE GAUSS MAP AND THE ... whether we may show a relation between of the ramification of the Gauss map and the total curvature of a complete minimal surface The main purpose of this article is to give an affirmative answer...
Ngày tải lên: 14/10/2015, 07:57
Báo cáo lâm nghiệp: " Influence of a planting hole application of dolomitic limestone powder and basalt grit on the growth of Carpathian birch (Betula carpatica W. et K.) and soil chemistry in the air-polluted Jizerské hory Mts." pptx
... Podrázský and Balcar (1996) and Geibe et al (2003) On the other hand, the applied basalt grit increased the concentration of exchangeable K; probably as a consequence of silicate weathering In the ... Spekol 210 apparatus, plant available Ca and Mg by AAS (Atomic Absorption Spectroscopy) The samples of assimilatory tissues and soil samples were analyzed at the Tomáš Laboratory using the procedures ... optimal The material was, however, a waste of a local quarry and there was a request for its testing as a cheap environmentally -friendly basic amendment at that time A scaled rod was used to measure...
Ngày tải lên: 07/08/2014, 10:22
Tài liệu Cancer Pain Management: A perspective from the British Pain Society, supported by the Association for Palliative Medicine and the Royal College of General Practitioners docx
... physicians and other healthcare professionals who treat pain from cancer at any stage of the disease with the hope of raising awareness of the types of therapies that may be appropriate and increasing ... working and the education of all healthcare professionals involved in the treatment of cancer pain • The principles of pain management and palliative care for adult practice are relevant to paediatrics, ... in particular may have under-treated pain Primary care teams supported by palliative care teams are best placed to initiate and manage cancer pain therapy, but education of patients, carers and...
Ngày tải lên: 14/02/2014, 21:20
Tài liệu Báo cáo Y học: Thermostability of manganese- and iron-superoxide dismutases from Escherichia coli is determined by the characteristic position of a glutamine residue pdf
... d(5¢-AACAACGCAGCTGGGCTCTG GAACCAT), ECF -A1 41Q d(5¢-TCAACCTCTAACCAG GCTACTCCGCTG) ECM-G77Q d(5¢-AACAACGCTGG CCAGCACGCTAACCAC) and ECM-Q14 6A d(5¢-TCT ACTGCTAACGCGGATTCTCCGCTG) following the manufacturer’s ... induced simultaneously after inoculation of media with cultures grown to exponential phase in the absence of paraquat and IPTG (Materials and methods [24]) The final concentration of paraquat and IPTG ... carried out using the CARA and ENCAD algorithms included in the GENEMINE program Bacterial strains and vectors The mutagenesis and expression phagemid, pGHX(–) was produced in our laboratory and...
Ngày tải lên: 21/02/2014, 01:21
SAVINGS BANKS AND THE DOUBLE BOTTOM-LINE: A profitable and accessible model of finance doc
... List of Tables Table Table Table Table Table Loan size and average savings balances for commercial banks Loan size and average savings balances for savings banks Savings banks’ lending volumes and ... Finally, there are the large state banks with a specific savings mandate that are common throughout East Asia and some parts of Latin America Clearly the regional characterisations of these different ... there has always been a clear dual mandate to (a) reach a target group not well served by commercial banks but (b) try and make a reasonable profit so that the outreach achieved can be sustained...
Ngày tải lên: 06/03/2014, 10:20
Báo cáo khóa học: Mutational and computational analysis of the role of conserved residues in the active site of a family 18 chitinase docx
... Asp140, Asp142, Glu144 and Asp215 were mutated individually to asparagine and alanine, Tyr10 and Tyr214 were replaced by Phe, and Ser93 was replaced by alanine All clones expressing ChiB variants ... in the pH 4.2– 8.0 range, and a marked increase in Km at alkaline pH (Table 2, Fig 3) The D215N and D140N mutants displayed an acidic shift in the pH-activity profiles, whereas the Y214F and the ... pKa calculations pKa values for Asp140, Asp142, Glu144 and Asp215 were calculated in several ChiB mutants as described in Materials and methods (Table 3) Calculations were primarily based on the...
Ngày tải lên: 07/03/2014, 14:20
Báo cáo khoa học: The propeptide in the precursor form of carboxypeptidase Y ensures cooperative unfolding and the carbohydrate moiety exerts a protective effect against heat and pressure pot
... Isolation and physicochemical properties of yeast proteinase A and C Agric Biol Chem 31, 357–367 Aibara, S., Hayashi, R & Hata, T (1971) Physical and chemical properties of yeast proteinase C Agric ... and an a- helix rich domain on the right side Thermodynamic properties of CPY and proCPY Thermodynamic parameters were calculated based on Eqns (2–6) to compare qualitatively the temperature and ... or was obtained from Oriental Yeast Co (Lot 21003805) (Osaka, Japan) and proCPY was prepared as the same manner as CPY, with minor modifications Dgly CPY and Dgly proCPY, in which the asparagine...
Ngày tải lên: 07/03/2014, 21:20
Báo cáo Y học: Kinetic and biochemical analyses on the reaction mechanism of a bacterial ATP-citrate lyase ppt
... dissociation (AB) are shown in lanes and 4, the individual AclA subunits (a) are shown in lanes and 5, and AclB subunits (b) in lanes and Molecular masses (kDa) are indicated on the side of each panel The ... phosphorylation of the a subunit Another function of AclB was found to be stabilization of the enzyme, as AclB prevented the degradation of AclA that was otherwise observed in the absence of AclB After ... into account the reaction mechanism of mammalian ACL [23], the nal step of the reaction can be assumed to be the nucleophilic attack of CoA to the phosphorylated carbonyl carbon of citryl phosphate,...
Ngày tải lên: 08/03/2014, 22:20
Báo cáo " Influence of laser parameters on the stationary operation of a two-mode random micro laser " pdf
... studying the influence of laser parameters on saturated values of mode photon densities, we vary one of parameters in table and remain invariable all the rest of parameters The obtained results are ... Hoang, M.H Hanh / VNU Journal of Science, Mathematics - Physics 23 (2007) 139-142 Discussion and conclusion In the stationary operation of two-mode random microlaser, the variation of laser parameters ... makes the decrease of the one of other mode The reason perhaps is due to the conservation of energy in the operation of two-mode random microlaser However, this result reflects the energy transformation...
Ngày tải lên: 14/03/2014, 13:20
Báo cáo khoa học: Esculentin-1b(1–18) – a membrane-active antimicrobial peptide that synergizes with antibiotics and modifies the expression level of a limited number of proteins in Escherichia coli doc
... where A and B are the MICs of drug A and drug B in the combination, MICA and MICB are the MICs of drug A and drug B alone, FICA and FICB are the FICs of drug A and drug B and n is the number of ... permeation/proteome proteome of the target microorganism and no microbial resistance; and (b) the design of potential coadjuvants of those antimicrobial agents that are already available after ... ML, Maisetta G, Di Luca M, Gaddi LM, Esin S, Florio W, Brancatisano FL, Barra D, Campa M & Batoni G (2008) Comparative analysis of the bactericidal activities of amphibian peptide analogues against...
Ngày tải lên: 16/03/2014, 00:20
Research " THE RATE OF RETURN TO EDUCATION AND THE GENDER EARNINGS DIFFERENTIAL : A COMPARISON OF THE UNITED STATES AND THE REPULIC OF IRELAND " ppt
Ngày tải lên: 16/03/2014, 03:20
Báo cáo khoa học: The use of recombinant protein and RNA interference approaches to study the reproductive functions of a gonad-stimulating hormone from the shrimp Metapenaeus ensis ppt
... primers (forward, 5¢-TAATACGACTCACTATAGGTACTATG TATCGCATGCCAAT-3¢; reverse, 5¢-TAATACGACTC ACTATAGGTACTTTAAAGTCCCGGGTTGA-3¢) For PCR, the reaction mix consisted of · Taq buffer containing 1.5 mm ... of the eyestalk (open bar) and thoracic ganglia (diagonally shaded bars) of females The percentage indicates the GSI of the females M (B) indicates the expression pattern of MIH-B in the same ... culture tanks At 24, 48 and 72 h after injection, the hepatopancreas and ovary of the shrimp were dissected for total RNA preparation, and the hemolymph samples were collected for SDS ⁄ PAGE and western...
Ngày tải lên: 16/03/2014, 05:20
Báo cáo khoa học: Phosphorylation modulates the local conformation and self-aggregation ability of a peptide from the fourth tau microtubule-binding repeat pdf
... negative charge at neutral pH, affects the electrostatic potential and quite often the conformation of the modified protein Even in the absence of rearrangement, the change in the electric field and ... and an intraresidue hydrogen bond between the nearby amide proton and the phosphate group As the pH increased, deprotonation began at the phosphate group, and the hydrogen bond began to surpass ... comparison of the chemical shifts of NH and aH between the nonphosphorylated and phosphorylated peptides is summarized in Fig The chemical shift deviations of NH and aH reflect changes in the...
Ngày tải lên: 16/03/2014, 05:20
Báo cáo Y học: Incorporation of 3-nitrotyrosine into the C-terminus of a-tubulin is reversible and not detrimental to dividing cells potx
... dividing the optical density of each band stained with antibodies to Glu- and nitrotyrosinated tubulin by that of an identical sample stained with DM 1A antibody Capabilities of nitrotyrosinated and ... nitrotyrosination of a- tubulin and cellular dysfunction 10 11 12 13 14 15 ACKNOWLEDGEMENTS 16 We thank Drs Carlos E Argarana and Mario Guido for critical ˜ reading of the manuscript, Mrs S N Deza and Mrs ... of optical density values for pellet and supernatant, multiplied by 100 The same formula was used to calculate percentage of assembly from radioactivity values Cell viability and proliferation...
Ngày tải lên: 17/03/2014, 10:20
Báo cáo Y học: The unorthodox histidine kinases BvgS and EvgS are responsive to the oxidation status of a quinone electron carrier ppt
... nonradioactive ATP were added After the addition of Q-0 and/ or ATP samples were taken immediately and after 0.5, 1, 2, 4, 8, 16 and 32 min; the reaction was stopped by the addition of sample buffer The half-life ... of a cell, and it was recently shown that they can bind small ligands such as FAD and ATP [13,29,31] In fact, mutations in this domain have been reported which cause either the inactivation of ... note that the PAS domain of the phosphorelay histidine kinase A of Bacillus subtilis was recently shown to be a catalytic ATP-binding domain [31] As the PAS domain of BvgS contains a putative ATP...
Ngày tải lên: 17/03/2014, 23:20
Báo cáo khoa học: Substrate specificity of the human UDP-glucuronosyltransferase UGT2B4 and UGT2B7 Identification of a critical aromatic amino acid residue at position 33 doc
... CTGGTGTGGCCCACAGAATACAGCCACTGGATGAATATAAAG CTTTATATTCATCCAGTGGCTGTATTCTGTGGGCCACACCAG CTGGTGTGGGCAGCAGAACTCAGCCATTGGATGAATATAAAG CTTTATATTCATCCAATGGCTGAGTTCTGCTGCCCACACCAG CTGGTGTGGGCAGCAGAATACAGCCATTGGATGAATATAAAG ... enhanced apparent affinity of the mutant For both substrates, the mutation decreased the Vmax values On the other hand, the Vmax of the mutant towards 17-epiestriol was slightly increased and the ... glucuronidating enzymes in Caucasian and African-American subjects and their impact on the metabolism of 7-ethyl-10-hydroxycamptothecin and flavopiridol anticancer drugs J Pharmacol Exp Ther 307,...
Ngày tải lên: 23/03/2014, 09:21