retinol retinal and retinoic acid are the active forms of vitamin a
Báo cáo khoa học: Studies on the regulatory properties of the pterin cofactor and dopamine bound at the active site of human phenylalanine hydroxylase pptx
Ngày tải lên :
17/03/2014, 09:20
... cofactor onto the structure of the ligandfree rPAH (containing the regulatory and catalytic domains) [19] revealed that both the reduced and the oxidized cofactor interact with the N-terminal ... autoregulatory sequence (Fig 4C and Table 1) and thus explaining the complete reversal of the pterin cofactor as a negative effector (Figs and 3A, B) When the crystal structure of the hPAHỈadrenaline/ ... the reduction of the active site iron in addition to its binding at the catalytic site as part of a catalytically active ternary complex Based on the crystal 3.0 structure of a ligand-free dimeric...
- 10
- 470
- 0
Báo cáo khoa học: Involvement of NF-jB subunit p65 and retinoic acid receptors, RARa and RXRa, in transcriptional regulation of the human GnRH II gene pot
Ngày tải lên :
16/03/2014, 10:20
... ACTAAGCTTAAAAGGGGACTTCTCTGGCAGTGTTCAGGGGTGGAGG ACTAAGCTTAAAAGGGGACTTCTCTGTAATGGTTCAGGGGTGG ACTAAGCTTAAAAGGGGACTTCTAGGGCATGGTTCAGGGG ACTAAGCTTAAAAGGGGACTGATCTGGCATGGTTCAGGGG ACTAAGCTTAAAAGGGGCATTCTCTGGCATGGTTCAGGGG ACTAAGCTTAAAAGTTGACTTCTCTGGCATGGTTCAGGGG ... Mut10 ACTAAGCTTAAAAGGGGACTTCTCTGGCATGGTTCAGGTTTGGAGGCACCTGGGA ACTAAGCTTAAAAGGGGACTTCTCTGGCATGGTTCCTGGGTGGAGGCACCTG ACTAAGCTTAAAAGGGGACTTCTCTGGCATGGGGCAGGGGTGGAGGCAC ACTAAGCTTAAAAGGGGACTTCTCTGGCAGTGTTCAGGGGTGGAGG ... lysate was prepared and used for luciferase and b-galactosidase assays Luciferase values are normalized by b-galactosidase expression and are shown as percentage changes in relative promoter activities...
- 12
- 399
- 0
Báo cáo y học: " The angiogenic factor midkine is regulated by dexamethasone and retinoic acid during alveolarization and in alveolar epithelial cells" potx
Ngày tải lên :
12/08/2014, 14:20
... or CSO alone (20 μl) via intraperitoneal (IP) injection daily from PN3-14; (3) DEX and RA at doses and days as above; (4) saline and CSO at doses and days above; and (5) control (same handling, ... secondary septation and large terminal air sacs, whereas RA-treated animals develop smaller, more numerous alveoli DEXinduced changes are ameliorated in animals that receive concomitant DEX+RA administration ... part of the animal studies, performing statistical analyses, performing real-rime PCR analysis, and drafting the manuscript SJG was responsible for some animal studies and measuring radial alveolar...
- 10
- 231
- 0
Báo cáo y học: Esterified Hyaluronic Acid and Autologous Bone in the Surgical Correction of the Infra-Bone Defects"
Ngày tải lên :
03/11/2012, 11:35
... before treatment and at 10 days, and 6,9, and 24 months after treatment Surgical Technique After local anaesthesia, intrasulcular incisions were made at the buccal and lingual sides with Bard-Parker ... fact, the Hyaloss® matrix has a dual function: on one hand its physiochemical properties facilitate the application of bone graft in the damaged site and on the other hand, it creates an environment ... Pianigiani E, Andreassi A, Taddeucci P, Alessandrini C, Fimiani M, Andreassi L A new model for studying differentiation and growth of epidermal cultures on hyaluronan-based carrier Biomaterials...
- 7
- 769
- 0
Safeguarding Public and Environmental Health: What are the Necessary Requirements of UV Reactor Validation Protocols?
Ngày tải lên :
05/09/2013, 09:08
... more logical approach is to calculate a safety factor for the equipment based on the uncertainty during validation, and apply it against the equipment performance rather than against the target UV ... based on their actual measured performance When the challenge organism is not the same as the target organism and does not have the same UV sensitivity, there are several ways to assess reactor ... monitoring can vary between the validation and a specific operating site, due to differences in any of the spectra (e.g., water absorption during validation and at the operating site) The USEPA draft...
- 8
- 545
- 0
Tài liệu Báo cáo khoa học: Activation loop 3 and the 170 loop interact in the active conformation of coagulation factor VIIa pdf
Ngày tải lên :
18/02/2014, 08:20
... calculated by global fitting of binding data to a : model using the software Biaevaluation 4.1 supplied by the manufacturer (Biacore AB) N-terminal pegylation and carbamylation In the pegylation ... and S1 pocket maturation but at the same time an unaltered conformational distribution of the N-terminal tail and a normal response to TF Discussion Fig N-terminal pegylation of G37 2A- FVIIa and ... in the published alanine scanning mutagenesis study of FVIIa [13], and investigated the effects of the mutation on the enzymatic maturation of FVIIa and on the response of FVIIa to TF Our measurements,...
- 11
- 619
- 0
Báo cáo khóa học: Mutational and computational analysis of the role of conserved residues in the active site of a family 18 chitinase docx
Ngày tải lên :
07/03/2014, 14:20
... The pKa of Asp140 is much lower than that of Asp142 and Glu144 in all situations where all three residues are present and the one proton shared by Asp140 and Asp142 appears to remain on Asp142 ... in the pH 4.2– 8.0 range, and a marked increase in Km at alkaline pH (Table 2, Fig 3) The D215N and D140N mutants displayed an acidic shift in the pH-activity profiles, whereas the Y214F and the ... environmental factors that are taken into account in the calculations (background charges, desolvation penalty and the interaction with other titratable residues), the first factor was found to be the major...
- 10
- 651
- 0
Báo cáo khoa học: Homoadenosylcobalamins as probes for exploring the active sites of coenzyme B12-dependent diol dehydratase and ethanolamine ammonia-lyase docx
Ngày tải lên :
07/03/2014, 21:20
... dehydratase and ethanolamine ammonia-lyase Results Coenzymic activity of the coenzyme analogues in the diol dehydratase and ethanolamine ammonia-lyase reactions Coenzymic activity of homoadenosylcobalamins ... homoadenosylcobalamins was measured with AdoCbl-dependent ethanolamine ammonia-lyase as well The time courses of the ethanolamine ammonia-lyase reaction using AdoMeCbl and AdoEtCbl at a concentration of ... value was about 0.27% that for AdoCbl, and the rate of mechanism-based inactivation (kinact) with this analogue was as slow as that with the regular coenzyme As judged from the kcat ⁄ kinact value,...
- 10
- 444
- 0
Báo cáo khoa học: Do N-terminal nucleophile hydrolases indeed have a single amino acid catalytic center? Supporting amino acid residues at the active site of penicillin G acylase pptx
Ngày tải lên :
16/03/2014, 01:20
... [16], as are the calculations of Galabov et al concerning the energetics of the alkaline hydrolysis of N-phenylacetamides [19] The investigation of Perakyla et al on the catalytic reaction of AGA, ... distribution of the real substrates and PGA active site In order to interpret the biphasic character of the Hammett plots available for AGA and GGT, it was suggested that the breakdown of the tetrahedral ... substrate, and the phenylmethanesulfonyl-SerB1 derivative These structures are mimics of the stationary points along the reaction pathway; they depict the changes in the spatial structure of the active...
- 10
- 425
- 0
Báo cáo khoa học: Apolipoproteins A-I and A-II are potentially important effectors of innate immunity in the teleost fish Cyprinus carpio pot
Ngày tải lên :
16/03/2014, 18:20
... as in (A) (E) Western blot analysis of the gel in (D) using a specific anti-apoA-II serum Fig 4B, the intact apoA-I (band a) , an intermediary fragment (band b) and a more stable third band (band ... on their innate immunity for survival As we described previously [8], apoA-I and apparently also apoA-II are locally synthesized and secreted in the carp epidermis as a nascent HDL particle Although ... that in the HDL particle, apoA-II should be much less exposed to the protease than apoA-I Discussion Although there are a few studies of mammalian HDL and its principal apolipoproteins A- I and...
- 7
- 397
- 0
Báo cáo khoa học: Classification of ATP-dependent proteases Lon and comparison of the active sites of their proteolytic domains pdf
Ngày tải lên :
16/03/2014, 18:20
... domains The locations and sequences of the Walker A and B motifs (AAA+ module) and of fragments of the proteolytic domains including catalytically active serine (S*) and lysine (K*) residues are ... Evolutionary classification and structural variation of Lon subfamilies According to the evolutionary classification of the AAA+ ATPases [7,9], Lon family belongs to the HslU/ClpX/Lon/ ClpAB-C clade and ... consists of two distinct branches, bacterial and archaeal Lon, on the basis of the differences in their AAA+ modules Our assignment of the two subfamilies agrees with both the above and the MEROPS...
- 7
- 487
- 0
Báo cáo Y học: A polymer with a backbone of 3-deoxy-D-glycero -D-galacto -non-2ulopyranosonic acid, a teichuronic acid, and a b-glucosylated ribitol teichoic acid in the cell wall of plant pathogenic Streptomyces sp. VKM Ac-2124 pdf
Ngày tải lên :
17/03/2014, 10:20
... that the percentages of the teichuronic acid, the Kdn-containing polymer, and the ribitol teichoic acid are 30 %, 10 %, and 10 % of the mass of the cell wall, respectively The three polymers altogether ... ester obtained upon alkaline hydrolysis of glucosylated ribitol teichoic acid from the cell wall of S azureus RIA 1009 [24] and based on the analysis of the products formed upon acid and enzymatic ... fi6 )a- D-Glcp-(1fi4)-b-D-ManpNAc3NAcA-(1fi was the major component of the cell wall preparation The absolute configuration of glucose (D-) isolated after hydrolysis of the total cell wall preparation was determined...
- 6
- 561
- 0
Báo cáo Y học: Role of tyrosine 238 in the active site of Rhodotorula gracilis D-amino acid oxidase A site-directed mutagenesis study docx
Ngày tải lên :
17/03/2014, 17:20
... side chain in substrate/product exchange to the active site of RgDAAO A superimposition of the active sites of yeast and mammalian DAAO [2–4] shows that the side chain of Y223 of RgDAAO overlaps ... formation and stabilization, and redox potentials of the free forms of wild-type and Y238 mutants of D-amino acid oxidase The semiquinone form of DAAO was achieved by anaerobic photoreduction, and ... 600ỈM)1Ỉcm)1, and a ratio A2 74 /A4 55 % 8.7 All of the Y238 mutants of RgDAAO are competent in catalysis: the anaerobic addition of an excess of D-alanine (trace in Fig 2) resulted in instantaneous enzyme...
- 10
- 496
- 0
Báo cáo khoa học: Probing the active site of Corynebacterium callunae starch phosphorylase through the characterization of wild-type and His334fiGly mutant enzymes pot
Ngày tải lên :
23/03/2014, 07:20
... CcStP, arguably accounting for the relative elevation of pKa of PLP phosphate in unliganded CcStP and the apparent lack of perturbation of pKa in the CcStP complex with arsenate The pH dependence of ... apparent saturation with substrate, and are given as relative values (rel kcat) of the catalytic rate for the wild-type (50 s)1; pH 7.0) and the catalytic rates of the H334G mutant in the absence (0.0015 ... upon the addition of the same concentration of phosphate pH profiles The pH dependences of logarithmic rates of the H334G mutant and wild-type are compared in Fig Data for the wild-type are taken...
- 11
- 430
- 0
Báo cáo Y học: Repression of FasL expression by retinoic acid involves a novel mechanism of inhibition of transactivation function of the nuclear factors of activated T-cells pptx
Ngày tải lên :
24/03/2014, 03:21
... whether RA modulates the activities of the enzymes that affect nuclear translocation and transcriptional activity of NFAT The NFAT proteins regulate the expression of FasL and a discrete set of ... substrate 4-methyl-lumbellifery-b-galactoside, and was normalized for protein content [30] A one-way analysis of variance was performed using GraphPad INSTATÒ (GraphPad Software, San Diego, CA, USA) ... lM, and NFAT binding was abolished in the presence of 1.0 lM all-trans-RA In contrast, SP-1 binding was similar at all concentrations of all-trans-RA tested All-trans-RA blocks NFAT translocation...
- 9
- 481
- 0
Báo cáo khoa học: An enzymatic mechanism for generating the precursor of endogenous 13-cis retinoic acid in the brain docx
Ngày tải lên :
29/03/2014, 00:20
... longitudinalis (Fig 7C, and 6), at the fasciculus longitudinalis medialis in the medulla oblongata (Fig 7C, and 7), and at the periventricular pretectum, which is a boundary area between brain and ... from the brain to enrich 13cIMH for western blot analysis and an in vitro enzymatic assay A faint, yet single band was observed in both the total brain homogenates and in the membrane fraction of ... that of the recombinant 13cIMH, although the intensity was lower than that of the recombinant protein (Fig 7B) The molecular weight of the band also matched the calculated molecular weight obtained...
- 15
- 357
- 0
Báo cáo sinh học: " Possible active origin of replication in the double stranded extended form of the left terminus of LuIII and its implication on the replication model of the parvovirus" pptx
Ngày tải lên :
19/06/2014, 08:20
... a is identical to b GAG GA GAG Bam HI AG T AG GAG AG CTC GAG T 3’ b T A 5’ TC GAG AG T GAG AG GA GAG T Bam HI T 3’ A 5’ CTC TC aa CT CTC bb aa GAG T A GA GAG ~806 bp AG A T TC CTC is identical ... collected the data resulting from the transfection of LuIII Lt-Lt/pGlu∆Xba, contributed in the analysis and interpretation of the data, participated in the idea and design of the models proposed and ... GAG TC (1) 5’ A T T A 5’ CTC (278) (278) (278) (278) 3’ GA GAG GAG (1) GAG AG Bam HI Bam HI T AG a 3’ GAG CT CTC 5’ A T T A b 5’ TC CTC 3’ GA T GA GAG Bam HI CTC GAG a CT 5’ A T 3’ T GA GA GAG...
- 11
- 678
- 0
báo cáo hóa học:" Possible active origin of replication in the double stranded extended form of the left terminus of LuIII and its implication on the replication model of the parvovirus" ppt
Ngày tải lên :
20/06/2014, 04:20
... a is identical to b GAG GA GAG Bam HI AG T AG GAG AG CTC GAG T 3’ b T A 5’ TC GAG AG T GAG AG GA GAG T Bam HI T 3’ A 5’ CTC TC aa CT CTC bb aa GAG T A GA GAG ~806 bp AG A T TC CTC is identical ... collected the data resulting from the transfection of LuIII Lt-Lt/pGlu∆Xba, contributed in the analysis and interpretation of the data, participated in the idea and design of the models proposed and ... GAG TC (1) 5’ A T T A 5’ CTC (278) (278) (278) (278) 3’ GA GAG GAG (1) GAG AG Bam HI Bam HI T AG a 3’ GAG CT CTC 5’ A T T A b 5’ TC CTC 3’ GA T GA GAG Bam HI CTC GAG a CT 5’ A T 3’ T GA GA GAG...
- 11
- 580
- 0
Báo cáo y học: "The active metabolite of leflunomide, A77 1726, increases the production of IL-1 receptor antagonist in human synovial fibroblasts and articular chondrocytes" ppsx
Ngày tải lên :
09/08/2014, 01:23
... macrophages, into the joint Local release of proinflammatory mediators and metalloproteinases causes joint cartilage destruction and leads to the perpetuation of joint inflammation Potential direct ... direct anti-inflammatory effects of A7 7 1726 on joint cells are thus of interest because of their relevance to the effectiveness of leflunomide in treating RA and other cartilage-damaging diseases ... (IL-1Ra) in human synovial fibroblasts and de-differentiated articular chondrocytes (a) Human osteoarthritis (OA) synovial fibroblasts (passage 1) and (b) de-differentiated human OA articular chondrocytes...
- 9
- 437
- 0
Báo cáo y học: " Regulation of Sox9 activity by crosstalk with nuclear factor-κB and retinoic acid receptors" pptx
Ngày tải lên :
09/08/2014, 10:22
... experiments Panels (b) and (c): data are expressed as ratios of intensities of NF-κB or RARα to β-catenin and are means ± standard error Data were evaluated by one-way analysis of variance and Tukey's ... equal loading Panels b to d: data are ratios of matrix gene: Gapdh transcript levels normalized as a fraction of the ratios in untreated cultures (first bar), and are expressed as means ± standard ... normalized as a fraction of the ratio in untreated cultures (first bar), and are expressed as means ± standard error Data were evaluated by repeated measures analysis of variance and Tukey's...
- 12
- 382
- 0