remedies of the landowner against misconduct by the holder of a time limited interest

not a suicide pact the constitution in a time of national emergency sep 2006

not a suicide pact the constitution in a time of national emergency sep 2006

Ngày tải lên : 10/06/2014, 23:24
... from a feather quill It also means that they tend to be pragmatic (pragmatism is the American national culture), hence forward-looking rather than slaves to history Anyway, they are lawyers rather ... sense of what the case is about and what the statute is about before starting to parse the statute Judicial bias in the pejorative sense means taking account of considerations, such as a litigant’s ... so by default find themselves making decisions in much the same way that other Americans do by balancing the anticipated consequences of alternative outcomes and picking the one that creates the...
  • 186
  • 1K
  • 0
báo cáo sinh học:" Using nurses to identify HAART eligible patients in the Republic of Mozambique: results of a time series analysis" potx

báo cáo sinh học:" Using nurses to identify HAART eligible patients in the Republic of Mozambique: results of a time series analysis" potx

Ngày tải lên : 18/06/2014, 17:20
... design of the data, participated in the data analysis and drafted the original text MAM participated in the data analysis and made significant comments on progressive drafts MAM was supported in part ... this analysis Cox proportional hazards regression was then used to compare the hazard rates at which these patients started HAART before and after the intervention, using the date of the initial ... on HAART each month (count variable), compared before and after the intervention We first evaluated the bivariate associations between the average number of patients starting HAART per month and...
  • 9
  • 492
  • 0
báo cáo hóa học:" Research Article Evaluation and Design Space Exploration of a Time-Division Multiplexed NoC on FPGA for Image Analysis Applications" docx

báo cáo hóa học:" Research Article Evaluation and Design Space Exploration of a Time-Division Multiplexed NoC on FPGA for Image Analysis Applications" docx

Ngày tải lên : 21/06/2014, 20:20
... exchange data at least at the same rate in order to achieve real time For the NoC architecture, four types of data are defined by analyzing multispectral image algorithms Each data has an identical number ... by a multispectral camera For the art authentication process, OI is the information of the true picture, and the CIs are the others “similar” candidates With the comparison process of the authentication ... The data structure is dynamic in order to adapt to different types of data The length of packet and data, number and size of flits, and the depth of VC are all parameterized The size of flits can...
  • 15
  • 389
  • 0
Báo cáo hóa học: " Research Article Modelling and Comparative Performance Analysis of a Time-Reversed UWB System" doc

Báo cáo hóa học: " Research Article Modelling and Comparative Performance Analysis of a Time-Reversed UWB System" doc

Ngày tải lên : 22/06/2014, 19:20
... by the channel [27] Also, a quasistationary channel is assumed, such that it remains time- invariant for the transmission of a full UWB packet Calculations are based upon the CM1 channel scenario ... various signal degradations and error performance analysis, Section overviews a UWB and TR-UWB simulation, together with a comparative analysis of the theoretical and simulated results for a timereversed ... exhibited by the system is defined as a statistically independent zero mean Gaussian random variable The ISI and MUI terms may be brought under the standard Gaussian approximation provided that the...
  • 11
  • 333
  • 0
Báo cáo hóa học: " A New Approach for Estimation of Instantaneous Mean Frequency of a Time-Varying Signal" doc

Báo cáo hóa học: " A New Approach for Estimation of Instantaneous Mean Frequency of a Time-Varying Signal" doc

Ngày tải lên : 23/06/2014, 01:20
... still there are many unresolved issues regarding the IF of the signal (A detailed review on the fundamentals of IF is available in [1].) It has been shown that the usual way of interpreting the ... a frequency that appears in the spectrum of the signal If the IF is interpreted as the derivative of the phase, then the IF can extend beyond the spectral range of the signal It has been recently ... IF characterizes the frequency dynamics of the signal RESULTS The proposed method of extracting the IF of a signal was applied to a set of synthetic signals with known IF laws, and a real-world...
  • 8
  • 355
  • 0
Báo cáo y học: "The Impact of a Nationwide Antibiotic Restriction Program on Antibiotic Usage and Resistance against Nosocomial Pathogens in Turkey"

Báo cáo y học: "The Impact of a Nationwide Antibiotic Restriction Program on Antibiotic Usage and Resistance against Nosocomial Pathogens in Turkey"

Ngày tải lên : 25/10/2012, 11:00
... non-parametric correlations A P value of less than 0.05 was regarded as significant Software package STATA 9.0 (USA) was used for the analysis Materials and Methods Results Hospital setting and antibiotic ... financial cost and resistance patterns of leading nosocomial pathogens (gram) and number of boxes were calculated from two databases, 1) Hospital pharmacy computer databases, and 2) International ... NARP was initiated in Turkey in February 2003 by a central regulation of Ministry of Health and was announced nation-wide via official newspaper of the state [11] This is a quasi-experimental...
  • 6
  • 692
  • 0
An analysis of nouns formed by suffixes in english   a case study of the textbook solutions   pre intermedite

An analysis of nouns formed by suffixes in english a case study of the textbook solutions pre intermedite

Ngày tải lên : 14/12/2013, 16:45
... learners a large of vocabulary and grammar There are many reading texts and basing on these reading texts, learners have the chance to know about the culture, the people of many countries in the ... female humans and animals Eg:  Lion (Noun): a large powerful animal of the cat family that hunts in group and lives in parts of Africa and southern Asia  Lioness (Noun): a female lion 15 g/ The ... who is the author of the James Bond in the 1930s Journalism: This noun is created by the way of adding the suffix “ism” to the noun “journal” (a newspaper or magazine that deals a particular subject...
  • 63
  • 988
  • 3
Tài liệu The message of a master - By John McDonald pdf

Tài liệu The message of a master - By John McDonald pdf

Ngày tải lên : 15/12/2013, 06:15
... the great masses of humanity are using the Law destructively, or partially so, and the scales are balanced against them Here and there, among the masses, we find an occasional outstanding figure ... inferior creatures as the beasts of the field, the birds of the air and the fish of the sea are bountifully supplied For any man, no matter what his station in life, to take the stand that it is the ... convinced that I had met my deliverer, and at the close of the performance was overjoyed at his invitation to accompany him to a nearby café I noticed that the attention of those in the café was drawn...
  • 50
  • 861
  • 0
Tài liệu Báo cáo khoa học: Modulation of a-synuclein aggregation by dopamine in the presence of MPTP and its metabolite pptx

Tài liệu Báo cáo khoa học: Modulation of a-synuclein aggregation by dopamine in the presence of MPTP and its metabolite pptx

Ngày tải lên : 14/02/2014, 19:20
... of 50 lm dopamine on the aggregation process Dopamine delayed the lag phase of aggregation marginally to 95.5 h from 86.8 h in the presence of MPTP alone The apparent rate constant of aggregation ... signal The apparent rate constant (kapp) is ⁄ s and lag time is calculated to be x0 ) 2s Chromatographic analysis RP-HPLC analysis of the samples was carried out to determine the residual amounts of ... be beneficial against a- synuclein aggregation in the substantia nigra pars Modulation of a- synuclein aggregation compacta of an MPTP-induced mouse model of Parkinson’s disease [35] It has recently...
  • 11
  • 754
  • 0
Tài liệu The Role of BCG Vaccine in the Prevention and Control of Tuberculosis in the United States: A Joint Statement by the Advisory Council for the Elimination of Tuberculosis and the Advisory Committee on Immunization Practices docx

Tài liệu The Role of BCG Vaccine in the Prevention and Control of Tuberculosis in the United States: A Joint Statement by the Advisory Council for the Elimination of Tuberculosis and the Advisory Committee on Immunization Practices docx

Ngày tải lên : 15/02/2014, 13:20
... National Association of State Public Health Veterinarians Keith A Clark, D.V.M., Ph.D Texas Department of Health Austin, TX National Vaccine Program Anthony Robbins, M.D Office of the Assistant ... Montreal (Montreal, Canada) Vaccine Efficacy Reported rates of the protective efficacy of BCG vaccines might have been affected by the methods and routes of vaccine administration and by the environments ... available data concerning the protective efficacy afforded by both BCG vaccination of adults and the type of vaccine strain administered precluded the inclusion of these factors as covariates in the...
  • 27
  • 1.3K
  • 3
Tài liệu Báo cáo khoa học: The mechanism of a-proton isotope exchange in amino acids catalysed by tyrosine phenol-lyase doc

Tài liệu Báo cáo khoa học: The mechanism of a-proton isotope exchange in amino acids catalysed by tyrosine phenol-lyase doc

Ngày tải lên : 19/02/2014, 16:20
... formed The anchoring of a- carboxylate and a- amino group in the external aldimine defines automatically the positions of the a- proton and the side chain of any bound amino acid The lability of the a- proton ... comparison of the rates of formal ÔreprotonationÕ (kr) for the normal and a- deuterated substrates in D2O allowed us to establish if there was any internal return of the a- proton after its abstraction ... L-methionine the rate of abstraction of the a- proton, leading to formation of the quinonoid intermediate, is less by a factor of 2.5 than for the reaction with L-phenylalanine The observed retardation...
  • 7
  • 532
  • 0
Tài liệu Báo cáo khoa học: Mapping of the epitope of a monoclonal antibody protecting plasminogen activator inhibitor-1 against inactivating agents pptx

Tài liệu Báo cáo khoa học: Mapping of the epitope of a monoclonal antibody protecting plasminogen activator inhibitor-1 against inactivating agents pptx

Ngày tải lên : 20/02/2014, 11:20
... Mab-1 and PAI-1 latency transition and PAI-1 inactivation by an insertion peptide In the presence of Mab-1, the half-life for latency transition of PAI-1 was increased by a factor of  1.5 The ... inhibitory activity of any of the variants, and all variants had IC50 values for inactivation by XR5118 indistinguishable from that of wt (data not shown) Whereas wt PAI-1 was totally resistant to ... monoclonal antibody against PAI-1, Mab-2 (Table 1) Mab-2 has an epitope of residues in hF and its flanking sequences [37] Mab-1 protection of PAI-1 against bis-ANS and XR5118 The IC50 values for bis-ANS...
  • 8
  • 547
  • 0
Tài liệu Báo cáo Y học: Thermostability of manganese- and iron-superoxide dismutases from Escherichia coli is determined by the characteristic position of a glutamine residue pdf

Tài liệu Báo cáo Y học: Thermostability of manganese- and iron-superoxide dismutases from Escherichia coli is determined by the characteristic position of a glutamine residue pdf

Ngày tải lên : 21/02/2014, 01:21
... d(5¢-AACAACGCAGCTGGGCTCTG GAACCAT), ECF -A1 41Q d(5¢-TCAACCTCTAACCAG GCTACTCCGCTG) ECM-G77Q d(5¢-AACAACGCTGG CCAGCACGCTAACCAC) and ECM-Q14 6A d(5¢-TCT ACTGCTAACGCGGATTCTCCGCTG) following the manufacturer’s ... (Vs) for a range of sample dilutions (200 lL sample per reaction) The slope of a plot of the reciprocal of the sample volume against Vb/Vs was used to calculate SOD activity [40] All assay constituents ... active site of the enzyme by reducing the occupied internal volume, allowing the introduction of an extra water molecule [29] Replacement of the same residue by Ala similarly maintains the same...
  • 12
  • 740
  • 0
Báo cáo khoa học: Suppression of a cold-sensitive mutant initiation factor 1 by alterations in the 23S rRNA maturation region pdf

Báo cáo khoa học: Suppression of a cold-sensitive mutant initiation factor 1 by alterations in the 23S rRNA maturation region pdf

Ngày tải lên : 06/03/2014, 00:21
... pTrc9 9A vector was used for cloning and overexpression of era, encoding the GTPase Era The primers used were as follows: era_F_NcoI, CGACCATGGCGAAC AGGCGTTGAAAAAAC; and era_R_SalI, CGAGTCGA CAGCCTTCCATCGGAGTTACT ... 10% of the value The figure is generated by the use of FYTIK software from raw data with a representative gradient profile was a decrease in the total amount of ribosomal particles (30S, 50S, and ... 70S molar ratio is adjusted to : 1.96 : 2.96 of the peak areas Each experiment was carried out three times The a and b values are given as means of these experiments, where the standard deviation...
  • 12
  • 439
  • 0
Báo cáo khoa học: Functional analysis of a murine monoclonal antibody against the repetitive region of the fibronectin-binding adhesins fibronectin-binding protein A and fibronectin-binding protein B from Staphylococcus aureus pot

Báo cáo khoa học: Functional analysis of a murine monoclonal antibody against the repetitive region of the fibronectin-binding adhesins fibronectin-binding protein A and fibronectin-binding protein B from Staphylococcus aureus pot

Ngày tải lên : 06/03/2014, 22:21
... followed by addition of peroxidase-conjugated goat anti-(rabbit IgG) Monoclonal antibodies against FnBRs of FnBPB A panel of mouse mAbs was produced against the recombinant repetitive region of FnBPB ... Biorad) was also used to dilute the analyte All of the assays were performed at 25 °C The sensorgrams (time course of the SPR signal in RU) were normalized to a baseline value of All sensorgram ... binding of the ligand (Fn) (manuscript in preparation) The second group of mAbs against FnBRB included antibodies that bound the antigen in the absence of Fn One of these mAbs, designated 15E11, was...
  • 16
  • 560
  • 0
Báo cáo khoa học: Kinetic characterization of methionine c-lyases from the enteric protozoan parasite Entamoeba histolytica against physiological substrates and trifluoromethionine, a promising lead compound against amoebiasis ppt

Báo cáo khoa học: Kinetic characterization of methionine c-lyases from the enteric protozoan parasite Entamoeba histolytica against physiological substrates and trifluoromethionine, a promising lead compound against amoebiasis ppt

Ngày tải lên : 07/03/2014, 05:20
... [10], and Porphyromonas gingivalis [11], parasitic protozoa such as Trichomonas vaginalis [12] and Entamoeba histolytica [13], and the plant Arabidopsis thaliana [14] MGL has been implicated in the ... and hamster models [26] (Kobayashi and Nozaki, unpublished results) The limited presence of MGL among organisms, and the remarkable differences in the toxicity of TFM against amoeba and mammalian ... development of new chemotherapeutics against amoebiasis For the further development of antiamoebic agents based on TFM, elucidation of the underlying reaction mechanisms of MGLs and the interaction of...
  • 13
  • 406
  • 0
Báo cáo khoa học: Structural and biological effects of a b2- or b3-amino acid insertion in a peptide Application to molecular recognition of substance P by the neurokinin-1 receptor ppt

Báo cáo khoa học: Structural and biological effects of a b2- or b3-amino acid insertion in a peptide Application to molecular recognition of substance P by the neurokinin-1 receptor ppt

Ngày tải lên : 08/03/2014, 08:20
... similar results All assays were done in parallel experiments with control at t ¼ for each peptide The percentage of degradation was calculated by comparing the area of the peaks of the intact ... and [b3-HAla9]SP may adopt conformations around residue that are analogous to those adopted by a- amino acids (Gly, Ala, Sar, Pro) To explain the slightly higher biological potency of [b2-HAla9]SP ... in the sequence of the C-terminal heptapeptide of NKA, another peptide of the tachykinin family that binds the NK-1 and NK-2 receptors [HGly8] NKA(4–10) is as potent as NKA and [Ala8]NKA on rabbit...
  • 11
  • 860
  • 0
Báo cáo Y học: The presence of a helix breaker in the hydrophobic core of signal sequences of secretory proteins prevents recognition by the signal-recognition particle in Escherichia coli doc

Báo cáo Y học: The presence of a helix breaker in the hydrophobic core of signal sequences of secretory proteins prevents recognition by the signal-recognition particle in Escherichia coli doc

Ngày tải lên : 08/03/2014, 09:20
... into pC4Meth94PhoE, the EcoRI/BamHI fragment of the plasmid was replaced by PCR fragments created using the PhoE forward primer (5¢-GCCGGAATTCTAATATGAAAAAGAGCACTCT GGC-3¢) and the 94PhoE reverse ... because of overloading of the SRP pathway The re-routing of (G-10L)prePhoE to the Sec translocon via the SRP instead of the SecB pathway could be explained by the increased hydrophobicity of the ... depleted of 4.5S RNA After radioactive labeling of the cells, the PhoE forms were immunoprecipitated and analyzed by SDS/PAGE (Fig 5) Depletion of 4.5S RNA did not result in the accumulation of precursors...
  • 8
  • 546
  • 0

Xem thêm