relations in a single table

... they are grouped by year and month in the pivot table Product is in the Column Labels area, Years and Date are in the Row Labels area, and Units is in the Values area If you calculate a running ... 2008, and begins again in January 2009 51 52 CHAPTER ■ CALCULATIONS IN A PIVOT TABLE If you calculate a running total with Years as the base field: • The subtotals for Years display the running ... custom calculations are available when summarizing data in a pivot table In addition to the default normal calculation, custom calculations provide eight different ways of viewing the summary results...

Ngày tải lên: 09/10/2013, 12:20

... Store the SQL String Me.lblSQLString.Text = strSQL ' Use the SQL String to build the data adapter and fill the data table Dim odaResults As New OleDb.OleDbDataAdapter(Me.lblSQLString.Text, _ BuildCnnStr("(local)", ... BuildCnnStr("(local)", "Northwind")) Dim dtResults As New DataTable() Try odaResults.Fill(dtResults) Catch excp As Exception MessageBox.Show(excp.Message) Exit Sub End Try ' Assign the data table to the data ... didn't have invoices; all the customers would appear, but only those invoices that had customers assigned to them would be displayed Note Normally, if your database is set up with referential integrity...

Ngày tải lên: 21/01/2014, 12:20

... U16-17R gac act cca cca tag atc act c cat gat gca cgc tct acg aga c ctg tga gga act act gtc ttc acg cag cac tcg caa cca ccc tat cag cca gcn cac aaa ggn ata gga gg acb acy gcn cct tch cct ttc ccc aat ... cells are liver macrophages and Hepatocytes are liver endothelial cells 2B-cells priate primer set (Table 2) A band of about 400 bp was seen after PCR analysis, indicating HHV- 6A was replicating in ... of HIV1 and HCV in the same cell may greatly aggravate the malady Our TEM analysis showed HHV- 6A and HCV in the same cells, with extracellular HIV-1 particles budding or adjacent to the infected...

Ngày tải lên: 18/06/2014, 18:20

... U16-17R gac act cca cca tag atc act c cat gat gca cgc tct acg aga c ctg tga gga act act gtc ttc acg cag cac tcg caa cca ccc tat cag cca gcn cac aaa ggn ata gga gg acb acy gcn cct tch cct ttc ccc aat ... cells are liver macrophages and Hepatocytes are liver endothelial cells 2B-cells priate primer set (Table 2) A band of about 400 bp was seen after PCR analysis, indicating HHV- 6A was replicating in ... of HIV1 and HCV in the same cell may greatly aggravate the malady Our TEM analysis showed HHV- 6A and HCV in the same cells, with extracellular HIV-1 particles budding or adjacent to the infected...

Ngày tải lên: 20/06/2014, 01:20

... 43–52, Karl-Franzens-Univ Graz, Graz, Austria, 2004 21 L C˘ dariu and V Radu, A Hyers-Ulam-Rassias stability theorem for a quartic functional equation,” a Automation Computers and Applied Mathematics, ... M Rassias, “On approximation of approximately linear mappings by linear mappings,” Journal of Functional Analysis, vol 46, no 1, pp 126–130, 1982 J M Rassias, “Solution of a problem of Ulam,” ... transformations,” Bulletin of the American Mathematical Society, vol 57, pp 223–237, 1951 Z Gajda, “On stability of additive mappings,” International Journal of Mathematics and Mathematical Sciences, vol...

Ngày tải lên: 22/06/2014, 06:20

... al.: Triple malignancy in a single patient including a cervical carcinoma, a basal cell carcinoma of the skin and a neuroendocrine carcinoma from an unknown primary site: A case report and review ... reported a case of four malignancies in the same patient including a cervical carcinoma and a basal cell carcinoma but in a metachronous setting [6] Human papilloma virus (HPV) infection has a wellestablished ... the analysis of the data HE approved the treatment and analyzed the literature data All authors read and approved the final manuscript Competing interests The authors declare that they have no...

Ngày tải lên: 10/08/2014, 23:20

... on findings at autopsy, aspiration or asphyxia, or asthma attack ARDS was clinically defined by meeting four criteria: acute onset; bilateral fluffy pulmonary infiltrates by x-ray; pulmonary artery ... pneumonia, and also demonstrated pathological evidence of DAD The one patient that died of an acute asthma attack also had ARDS, but it was the asthma attack that was the fatal event Respiratory ... TBSA burn Inhalation injury was present in 20% of all admitted burns Figure Brain deaths Brain injury accounted for 16% of all deaths Anoxic brain injury accounted for 48% of the brain deaths after...

Ngày tải lên: 13/08/2014, 20:21

... mdtLookupData DataTable object Listing 8.32 frmHowTo8_6.aspx: Tracking the DataTable Object Between Trips to the Server Private mdtLookupData As New DataTable() Private Sub Page_Load(ByVal sender As ... data grid is bound again by calling BindTheData() Listing 8.36 frmHowTo8_6.aspx: Canceling Editing/Adding a Record in the DataGrid Object Sub dgLookupData_Cancel(ByVal sender As Object, ByVal ... create a data table Then set the ' data source of the data grid odaTableData = New OleDb.OleDbDataAdapter("Select * From " & _ Me.lstLookupTables.SelectedItem.ToString, cnn) Dim ocbTableData As...

Ngày tải lên: 07/11/2013, 15:15

... the new table chosen in lstLookupTables as the Select command for the modaLookupData data adapter The data table called dtData is then filled and set as the data source for dgTableData Listing 8.10 ... dtData As New DataTable() Try ' Update the data adapter and data table to reflect the new data, ' and reassign the data source of the data grid modaLookupData = New OleDb.OleDbDataAdapter("Select ... Grabbing the data table from the DataSource ' property of the data grid ' saves a bunch of hassles trying to track the data table directly dtFromGrid = CType(dgTableData.DataSource, DataTable)...

Ngày tải lên: 14/12/2013, 20:16

... // Add table mappings da.TableMappings.Add( "Table" , "Orders"); da.TableMappings.Add( "Table1 ", "Order Details"); // Create the DataSet DataSet ds = new DataSet( ); // Fill the schema and data da.FillSchema(ds, ... da.FillSchema(ds, SchemaType.Mapped); da.Fill(ds); // Iterate over the table collection in the DataSet foreach(DataTable dt in ds.Tables) { schemaInfo.Append( "TABLE: " + dt.TableName + Environment.NewLine); ... SQL Server Books Online The GetSchemaTable( ) method of the DataReader also returns all column lengths The method returns a DataTable containing column metadata for a DataReader, where the ColumnSize...

Ngày tải lên: 24/12/2013, 05:15

... generating a thermally stable enzyme form from a thermally unstable one: frog, toad and newt DNases I all have a Ser205 insertion in a domain that contains an essential Ca2+binding site in the mammalian ... obtained from the Japan Snake Institute, Gunma, Japan Phenyl Sepharose CL-4B, DEAE Sepharose CL-6B and Superdex 75 were purchased from Amersham Pharmacia Biotech; Concanavalin A (Con A) agarose ... Yasuda, T., Sawazaki, K., Nadano, D., Takeshita, H., Nakanaga, M & Kishi, K (1993) Human seminal deoxyribonuclease I (DNase I): purification, enzymological and immunological characterization and...

Ngày tải lên: 20/02/2014, 23:20

... epidural analgesia and cesarean anesthesia (including anesthesia for retained placenta and complicated vaginal deliveries, antenatal or pre-operative consultation, and resident training) In some ... medical graduates to the specialty and dwindling immigration) and an increase in overall workload demand (particularly in obstetric anesthesia) [1] Obstetric anesthesia workload in Israel has increased ... epidural labor analgesia and cesarean delivery The OAAI is a formula composite comprising data taken from the annual numbers of epidurals and cesareans in each institution In this study, these data...

Ngày tải lên: 05/03/2014, 15:20

... canonical EF-hand motif and cause conformational changes in this motif The Ca2+ signal change and the accompanying conformational change in the canonical EF-hand are probably relayed to the SAM ... CD2.STIM1.EF increased, indicating that the inserted EF-hand motif at least partially maintains the natural helical structure after grafting The Ca2+ dissociation constant of CD2.STIM1.EF (512 lm) is in ... forms a globular domain to allow for cooperative Ca2+ binding, responding to a narrow range of free Ca2+ concentration change To examine the key determinants for Ca2+ binding and Ca2+-induced...

Ngày tải lên: 07/03/2014, 00:20

... 5¢-TCACCATAGGCATCAAGGAATCGCGAATCCGCCTCGTTCCGGCTAAGTAACATGGAGCAGGTCGCG ATTTCGACACAATTTATCAGGCGAGCACCAGATTCAGCAATTAAGCTCTAAGCC- 3¢ 5¢-GGCTTAGAGCTTAATTGCTGAATCTGGTGCTCGCCTGATAAATTGTGTCGAAATCCGCGATCTGCTCC ... 5¢-GCCTCGTTCCGGCTAAGTAACATGGAGCAGGTCGCGGATTTCGACACAATTTATCAGGCGA-3¢ 5¢-TCGCCTGATAAATTGTGTCGAAATCCGCGATCTGCTCCATGTTACTTAGCCGGAACGAGGC-3¢ 5¢-TCGCCTGATAAATTGTGTCGAAATCCGCGACCTGCTCCATGTTACTTAGCCGGAACGAGGC-3¢ ... 5¢-GGCTTAGAGCTTAATTGCTGAATCTGGTGCTCGCCTGATAAATTGTGTCGAAATCCGCGATCTGCTCC ATGTTACTTAGCCGGAACGAGGCGGATTCGCGATTCCTTGATGCCTATGGTGA-3¢ 5¢-GGCTTAGAGCTTAATTGCTGAATCTGGTGCTCGCCTGATAAATTGTGTCGAAATCCGCGACCTGCTCC ATGTTACTTAGCCGGAACGAGGCGGATTCGCGATTCCTTGATGCCTATGGTGA-3¢...

Ngày tải lên: 07/03/2014, 12:20

... TCC TGC CAC TGA CGT CCT ATT TTA ATA CTC C-3¢, and Acod (reverse): 5¢-CGC GGA TCC ATG GAA TCG ATG TAT AAA CGG TTT TCA GTT GAA GT-3¢, and the EcoRI restriction fragment of the chloroplast genome ... separating gel consisted of a 4–13% (w/v) acrylamide gradient whereas the stacking gel was 4% (w/v) acrylamide Final concentrations of Bistris and amino-ncaproic acid in gel buffer were 25 mM and ... were barely detectable (Fig 5A) , whereas synthesis of D2 and apoCP43 remained similar to those in the WT strain We noted that labelling of D1 and apoCP47 were clearly detectable in 40 pulses in...

Ngày tải lên: 07/03/2014, 15:20

... oleracea MDE line 103, B rapa MDE line R500 and LEA B napus cv Westar were aligned Amino acid residues at position 282 are shaded in black and indicated by the black arrow The amino acid residues at ... one at position 118 with asparagine instead of aspartic acid, while at the position 484 in Hero, aspartic acid is substituted by a glutamic acid residue HEA B rapa FAE1 has a serine residue at ... LEA B napus cv Westar is at position 282 While all functional elongases have a serine amino acid residue at that position, in the catalytically inactive protein from LEA cv Westar serine 282...

Ngày tải lên: 08/03/2014, 09:20

... were fixed and stained with an anti(human J-chain) Ig to verify the presence of intracellular J-chain A further attempt to directly quantify the amount of intracellular J-chain was avoided, as retention ... demonstrated that a sufficient amount of J-chain was available for SIgA complex formation One SIgA-producing clone (SIgA-3) along with pIgA-D and IgA-29 were analysed by SDS/PAGE gel and Western ... producing pIgA and SC resulted in clones producing SIgA (DAKO; : 3000 dilution) The absorbance was read by TitertekÒ Multiskan (ICN Flow, USA) The amount of IgA present in each supernatant was calculated...

Ngày tải lên: 18/03/2014, 01:20

... unfolding the I27 protein in D2O The pulling coordinate for the separating b-strands is defined as the distance between the first amino acid of strand A (Y9) and the last amino acid of strand ... result of a delicate balance between intramolecular and hydration interactions, D2O may alter the dynamics of protein function in subtle and non-intuitive ways.[32–35] Interestingly, in contrast to ... stability of proteins is not general, as some proteins are less stable in D2O than in H2O at room temperature.[29–31] Clearly then, the intramolecular and hydration interactions of proteins in...

Ngày tải lên: 22/03/2014, 18:20

... USA) Plasmids and cloning procedures For heterologous expression in yeast, N crassa HEX1 was amplified from a N crassa cDNA library using PCR with primer pair RE951 (AAGAATTCATGGGCTACTACGA CGAC) ... strain DH 5a was used (Invitrogen, Carlsbad, CA, USA) The yeast wild-type strain BY4742 was used The strain BY4742pex5D was obtained from the EUROSCARF strain collection (Frankfurt, Germany) and ... data indicated that a typical HEX1 crystal core was formed in yeast which is likely to contain only minor inclusions of peroxisomal matrix proteins A C Vps1p and Dnm1p: two dynamin-like proteins...

Ngày tải lên: 23/03/2014, 07:20

... pEBTet is AAGCTT GAATTCTGCAGAT TCGA gccacc ATGCGGGA (polylinker in bold, Kozak motif in lower case, cDNA underlined); the 3¢ interface is ATTTCTAGA TCCAGCAC For pEBTetD ⁄ ETTh, the 5¢ interface is ... eGFP, the 5¢ interface is GGTACCG CGGGCCCGGGATCCATC gccacc ATGG TGA; the 3¢ interface is CAAGTAAA GCGGCCGC For pEBTetD ⁄ eGFP, the 5¢ interface is identical; the 3¢ interface is CAAGTAAA GCGGCCGCGG ... SLC2 2A1 6h, the 5¢ interface is GGTACC CCCCCGGA; the 3¢ interface is ATGCCTGC GGGGATCCAC TAGTAACGGC CGCC AGTGTG CTGGAATTCT GCAGATATCC ATCACAC TGGCGGCC The cDNA of eGFP corresponds to GenBank entry...

Ngày tải lên: 23/03/2014, 09:21