reasons for hospitalized patients being at risk of malnutrition

báo cáo khoa học: " A systematic review of the effectiveness of interventions to improve post-fracture investigation and management of patients at risk of osteoporosis" docx

báo cáo khoa học: " A systematic review of the effectiveness of interventions to improve post-fracture investigation and management of patients at risk of osteoporosis" docx

... Reported reasons include: lack of consensus as to who is responsible for initiating treatment; lack of awareness by patients and physicians of the treatment guidelines and efficacy of medications for ... education (CME) program; list of at- risk patients given to PCP and discussed at meeting; printed educational materials and letter from HBCBSNJ to patient; automated phone call invitation for ... maximal rates of investigation and treatment In this particular study, 33% of patients did not receive appropriate care All of the studies reported treatment rates at six months follow-up, except for...

Ngày tải lên: 10/08/2014, 10:23

17 614 0
Báo cáo khoa học: "Medical treatment for the terminally ill: the ‘risk of unacceptable badness’"

Báo cáo khoa học: "Medical treatment for the terminally ill: the ‘risk of unacceptable badness’"

... virtually any treatment is fair game, even if it will nothing to revitalize the patient population of ICU patients who will die no matter what treatment is rendered them Medically inappropriate care ... pain, suffering, and discomfort The fundamental maxim for these patients should be comfort Extraordinary life support for patients predicted to die does not equal comfort care Competing interests ... examination of the medical and philosophical literature on the determination of death Dissertation Pittsburgh, PA: Duquesne University; 2004 Crippen D, Levy M, Whetstine L, Kuce J: Debate: What...

Ngày tải lên: 25/10/2012, 10:45

2 463 0
Familial breast cancer - The classification and care of women at risk of familial breast cancer in primary, secondary and tertiary care potx

Familial breast cancer - The classification and care of women at risk of familial breast cancer in primary, secondary and tertiary care potx

... for in secondary care • Women at high risk of developing breast cancer (that is, a 10-year risk of greater than 8% for women aged 40–49 years or a lifetime risk of 30% or greater) are cared for ... Women who are estimated to be at high risk (that is, a 10-year risk at age 40–49 years of greater than 8% or a lifetime risk of 30% or greater, or a 20% or greater chance of a faulty BRCA1, BRCA2 ... agreed information across localities NICE clinical guideline 41 – Familial breast cancer 10 Box Recommendations for information provision Standard written information for all women • Risk information...

Ngày tải lên: 15/03/2014, 00:20

50 462 0
building resilience adaptive strategies for coastal livelihoods most at risk to climate change impacts in central viet nam

building resilience adaptive strategies for coastal livelihoods most at risk to climate change impacts in central viet nam

... paths of resilience in relation to future climate change for the most at- risk coastal livelihood systems in the central region of Viet Nam It identifies measures for formulating adaptive strategies ... productivity/death of crops caused by shortage of irrigation water as commune situated at the end of the En River irrigation system - Cold weather: livestock die; farmers stay at home - Typhoon: loss of ... Improved access by the most at- risk to information on climate risks, adaptation measures, and market information can be provided through communication infrastructure Better climate change awareness,...

Ngày tải lên: 26/03/2014, 14:08

172 472 1
Báo cáo sinh học: " Molecular biodiversity of cassava begomoviruses in Tanzania: evolution of cassava geminiviruses in Africa and evidence for East Africa being a center of diversity of cassava geminiviruses" pptx

Báo cáo sinh học: " Molecular biodiversity of cassava begomoviruses in Tanzania: evolution of cassava geminiviruses in Africa and evidence for East Africa being a center of diversity of cassava geminiviruses" pptx

... TTACATCAC TACATCGGCCTTTGAGTCGC ATGG CTTATTAACGCCTATATAAAC ACC KSGGGTCGACGTCATCAATGA CGTTRTAC AARGAATTCATKGGGGCCCA RARRGACTGGC GTGACGAAGATTGCATTCT AATAGTATTGTCATAGAAG TAAGAAGATGGTGGGAATCC CGATCAGTATTGTTCTGGAAC ... AATAGTATTGTCATAGAAG TAAGAAGATGGTGGGAATCC CGATCAGTATTGTTCTGGAAC TGGTGGGAATCCCACCTT GTATTGTTATGGAAGGTGATA TATATGATGATGTTGGTC TAGAAGGTGATAGCCGTA TATATGATGATGTTGGTC TAGAAGGTGATAGCCGAAC EACMV-KE-[TZT] DNA-A fla ... and at 72°C For amplification of the partial DNA-B fragment (BC1/IR), PCR conditions were 30 cycles of 94°C for min, 55°C for min, 72°C for and an extension cycle of 10 at 72°C PCR products of...

Ngày tải lên: 18/06/2014, 22:20

23 612 0
báo cáo hóa học:" Molecular biodiversity of cassava begomoviruses in Tanzania: evolution of cassava geminiviruses in Africa and evidence for East Africa being a center of diversity of cassava geminiviruses" pot

báo cáo hóa học:" Molecular biodiversity of cassava begomoviruses in Tanzania: evolution of cassava geminiviruses in Africa and evidence for East Africa being a center of diversity of cassava geminiviruses" pot

... TTACATCAC TACATCGGCCTTTGAGTCGC ATGG CTTATTAACGCCTATATAAAC ACC KSGGGTCGACGTCATCAATGA CGTTRTAC AARGAATTCATKGGGGCCCA RARRGACTGGC GTGACGAAGATTGCATTCT AATAGTATTGTCATAGAAG TAAGAAGATGGTGGGAATCC CGATCAGTATTGTTCTGGAAC ... AATAGTATTGTCATAGAAG TAAGAAGATGGTGGGAATCC CGATCAGTATTGTTCTGGAAC TGGTGGGAATCCCACCTT GTATTGTTATGGAAGGTGATA TATATGATGATGTTGGTC TAGAAGGTGATAGCCGTA TATATGATGATGTTGGTC TAGAAGGTGATAGCCGAAC EACMV-KE-[TZT] DNA-A fla ... and at 72°C For amplification of the partial DNA-B fragment (BC1/IR), PCR conditions were 30 cycles of 94°C for min, 55°C for min, 72°C for and an extension cycle of 10 at 72°C PCR products of...

Ngày tải lên: 20/06/2014, 04:20

23 522 0
báo cáo hóa học:" Are Nepali students at risk of HIV? A crosssectional study of condom use at first sexual intercourse among college students in Kathmandu" pot

báo cáo hóa học:" Are Nepali students at risk of HIV? A crosssectional study of condom use at first sexual intercourse among college students in Kathmandu" pot

... variety of behaviours that put them at risk for serious health problems [6,7] College students are at risk of sexually transmitted infections, including HIV, due to their propensity to take risks, often ... Bureau of Statistics: Population Monograph of Nepal Kathmandu 2003 UNAIDS and World Health Organization: AIDS Epidemic Update Geneva 2009 National Centre for AIDS and STD Control: Cumulative ... the establishment of behavioural patterns throughout life [38-40]; and the recognition that sexual initiation at a very young age is a risk factor for pregnancies before the age of 20 and acquiring...

Ngày tải lên: 20/06/2014, 08:20

7 321 0
báo cáo khoa học: " Survey of smokers'''' reasons for not switching to safer sources of nicotine and their willingness to do so in the future" pdf

báo cáo khoa học: " Survey of smokers'''' reasons for not switching to safer sources of nicotine and their willingness to do so in the future" pdf

... previously attempted cessation or stated an expectation of quitting in the future This survey of current smokers obviously could offer no assessment of Page of (page number not for citation purposes) ... intervals (CIs) to give readers an indication of the robustness of the results but remind readers that interpretation of these is still only indicative of random error In surveys such as this, ... 56% (50%, 62%) Reasons for not considering switching1 I believe that using tobacco in any form is as bad for you as smoking I believe that using nicotine in any form is as bad for you as smoking...

Ngày tải lên: 11/08/2014, 18:20

8 361 0
A study on the use of communicative activities to improve ESP reading skills for civil engineering students at University of Civil Engineering

A study on the use of communicative activities to improve ESP reading skills for civil engineering students at University of Civil Engineering

... Introduction and definition of CLT 14 1.6.2 Basic features of communicative approach 14 1.6.3 Definition of communicative activities 15 1.6.4 Using of communicative activities in ... Supervisor: Prof Dr Hoàng Văn Vân HÀ NỘI – 2010 TABLE OF CONTENTS DECLARATION Acknowledgement Abstract Table of content Abbreviations Lists of Charts and Tables PART I: INTRODUCTION Rationale ... VIETNAM NATIONAL UNIVERSITY, HANOI UNIVERSITY OF LANGUAGES AND INTERNATIONAL STUDIES FACULTY OF POST-GRADUATE STUDIES VŨ THỊ THẢO A STUDY ON THE USE OF COMMUNICATIVE ACTIVITIES TO...

Ngày tải lên: 19/03/2015, 10:36

5 1,3K 6
Developing ESP supplementary reading exercises for second-year students at faculty of Nursing, Phu Tho Medical College  Xây dựng các bài tập đọc bổ trợ tiếng An

Developing ESP supplementary reading exercises for second-year students at faculty of Nursing, Phu Tho Medical College Xây dựng các bài tập đọc bổ trợ tiếng An

... a group of items that belong to a certain category The data of the present study were analyzed by means of both quantitative and qualitative statistics to reduce potential limitations of relying ... an attempt has been made to look into detail at one of the most characteristic features of ESP work: materials development As what the researcher have stated beforehand, there are a number of reasons ... evaluation of materials is a crucial task for language teachers That means besides the job of teaching, EFL teachers need the ability to evaluate teaching materials effectively Materials evaluation...

Ngày tải lên: 28/03/2015, 10:23

61 1,1K 0
A double blind randomized placebo controlled clinical trial on the supplementation of probiotics in the first six months of life in asian infants at risk of allergic diseases   effe

A double blind randomized placebo controlled clinical trial on the supplementation of probiotics in the first six months of life in asian infants at risk of allergic diseases effe

... 1-4 SUMMARY OF CLINICAL TRIALS EVALUATING THE ROLE OF PROBIOTIC SUPPLEMENTATION IN THE TREATMENT OF ATOPIC DERMATITIS 34 TABLE 1-5 SUMMARY OF CLINICAL TRIALS EVALUATING THE ROLE OF PROBIOTIC ... obvious reasons, effective strategies for the primary prevention of allergic diseases in high -risk infants with family history of atopy would be more attractive compared to treatment of established ... the postnatal maturation of the immune system and development of protective 10 mechanisms against atopy This hypothesis paves the way for the use of probiotics intervention as a strategy for the...

Ngày tải lên: 11/09/2015, 21:39

200 1,5K 0
Assessing latent inhibition deficits in youth at risk of conversion to psychosis

Assessing latent inhibition deficits in youth at risk of conversion to psychosis

... They found that East Asians showed greater activation in prefrontal and parietal attention regions associated with attentional control for the former condition rather than for the latter, while ... Study 3, as none of the UHR individuals in that study had received any form of anti-psychotic medication 9.1 Possible Applications of Latent Inhibition Before LI is applied outside of an experimental ... samples seems to have received relatively little attention from researchers working with at- risk populations: Latent Inhibition What is Latent Inhibition? Latent Inhibition (LI) is a cognitive...

Ngày tải lên: 30/09/2015, 14:23

68 281 0
Báo cáo y học: " Risk of malnutrition is associated with mental health symptoms in community living elderly men and women: The Tromsø Study" pdf

Báo cáo y học: " Risk of malnutrition is associated with mental health symptoms in community living elderly men and women: The Tromsø Study" pdf

... reference The odds ratio (OR) estimates were adjusted for potential confounders (age, marital status, smoking and educational level) The analysis of the relationship between the risk of malnutrition ... suggest a relatively stronger relationship between the risk of malnutrition and the median SCL-10 score in men than in women In men who were at risk of malnutrition (combining medium and high risk) , ... SCL-10 the assessment of the relationship between risk of malnutrition and mental health Increased risk of malnutrition (combining medium and high risk) was found in 7.1% of the individuals in...

Ngày tải lên: 11/08/2014, 15:22

8 402 0
Báo cáo hóa học: " Mutation or loss of Wilms’ tumor gene 1 (WT1) are not major reasons for immune escape in patients with AML receiving WT1 peptide vaccination" ppt

Báo cáo hóa học: " Mutation or loss of Wilms’ tumor gene 1 (WT1) are not major reasons for immune escape in patients with AML receiving WT1 peptide vaccination" ppt

... loss of the HLA-A2 allele, we analyzed HLA-A2 expression on leukemic blasts of patients In all patients more than 90% of blasts stained positive for HLA-A2 In none of the patients a difference of ... Dickinson) and data were analyzed using CellQuest software Results and Discussion Ten HLA-A2 positive patients with AML were analysed for mRNA expression levels of WT1 and for mutations of the WT1 ... cytometry at time of disease progression, consistent with downregulation of WT1 mRNA and protein as escape mechanism in this single patient WT1 mutations have been reported in about 10% of patients...

Ngày tải lên: 18/06/2014, 16:20

4 424 0
Báo cáo hóa học: " EQ-5D visual analog scale and utility index values in individuals with diabetes and at risk for diabetes: Findings from the Study to Help Improve Early evaluation and management of risk factors Leading to Diabetes (SHIELD)" potx

Báo cáo hóa học: " EQ-5D visual analog scale and utility index values in individuals with diabetes and at risk for diabetes: Findings from the Study to Help Improve Early evaluation and management of risk factors Leading to Diabetes (SHIELD)" potx

... available from >75% of each cohort (5,639 of 7,403 for low risk, 5,370 of 6,742 for high risk, and 3,849 of 5,000 for type diabetes) The sociodemographic characteristics of the baseline respondents ... significantly higher than the mean score for the high -risk group (p < 0.001) A greater proportion (34.5%) of respondents at low risk for diabetes rated their current state of health >90 on the VAS, compared ... respondents are representative of the U.S population with or at risk for diabetes, the EQ-5D utility scores would be useful for national and multinational comparisons for quality-adjusted life-year...

Ngày tải lên: 18/06/2014, 22:20

7 612 1
current conditions and assessment on the effects of the caring, supporting and treating activities for aids patients at adult outpatient clinics in 3 provinces of vietnam, 2009 - 2010

current conditions and assessment on the effects of the caring, supporting and treating activities for aids patients at adult outpatient clinics in 3 provinces of vietnam, 2009 - 2010

... treatment Diagram 3.5 Type of ARV treatment of the research patients before registering at the outpatient clinics Among 99 research patients who had received ARV treatment before registering at ... intoxication before ARV treatment, of which, most of them is at medium level: 53.3%; minor level: 41.9% The number of patients at serious level is low, accounting for 1.1%, the patients at extremely ... Anemias extend of the researched patients before ARV treatment: 53.4% patients have Hgb test result, of which, most of them are at medium level: 83.5%, the number of patients are at serious level:...

Ngày tải lên: 25/07/2014, 13:57

27 365 0
báo cáo khoa học: "Analysis of the recurrence risk factors for the patients with hepatocellular carcinoma meeting University of California San Francisco criteria after curative hepatectomy" pot

báo cáo khoa học: "Analysis of the recurrence risk factors for the patients with hepatocellular carcinoma meeting University of California San Francisco criteria after curative hepatectomy" pot

... also the risk factor of recurrence after hepatectomy Primary liver transplantation should be a treatment option for male patients Page of In conclusion, hepatectomy or liver transplantation for HCC ... the risk factors of tumor recurrence For the patients without or with limited risk factors of tumor recurrence, hepatectomy rather than liver transplantation will be the first choice of treatment ... Although hepatic resection is a safe therapeutic choice, the concern of the choice of hepatectomy in this group of patients is a higher risk of recurrence than transplantation The aims of this study...

Ngày tải lên: 09/08/2014, 01:24

6 337 0
Báo cáo y học: "How can we reduce the risk of serious infection for patients with systemic lupus erythematosus" ppt

Báo cáo y học: "How can we reduce the risk of serious infection for patients with systemic lupus erythematosus" ppt

... guidelines have not been developed for SLE With the exception of the live attenuated vaccines, other vaccinations should be kept up-to-date in patients with SLE Caring for patients with SLE includes commonsense ... prophylaxis for high risk patients Based on an estimated prevalence of 29% for serious infections among patients with SLE and the findings of Ruiz-Irastorza and colleagues, the number needed to treat ... related to anti-malarial treatment, including markers of SLE severity, since anti-malarials are more likely to be prescribed to patients with milder disease drugs as standard of care for all patients...

Ngày tải lên: 09/08/2014, 14:22

2 339 0
w