r in jacket zoning and scale up of a batch reactor

báo cáo hóa học:" A process evaluation of the scale up of a youth-friendly health services initiative in northern Tanzania" pot

báo cáo hóa học:" A process evaluation of the scale up of a youth-friendly health services initiative in northern Tanzania" pot

... immediate outcomes of the YFS training were evaluated using pre -and post-training questionnaires, training observations and informal interviews among health workers during training Intervention ... facilitate the provision of YFS, in terms of motivating and training health workers and addressing some infrastructural constraints Health worker attitudes and experience of reproductive health services ... Training of 24 DTs Evaluation activity 6-day training Jan-June 2005 Training with Manual 1: Eight training sessions of 208 health workers (6-day training) Training evaluation - 16 days observation...

Ngày tải lên: 20/06/2014, 08:20

12 370 0
The study on characteristics of  the image and value of  ultrasound, computed tomography in the diagnosis and follow up of hepatobiliary f

The study on characteristics of the image and value of ultrasound, computed tomography in the diagnosis and follow up of hepatobiliary f

... Kabaalioğlu A and colleagues reported the results of sonographic and CT findings in 87 patients during the initial phase and long-term follow -up 3 In 2012, Dusak Abdurrahim and colleagues described radiological ... 1.2 ADVANTAGES AND DISADVANTAGES OF THE RESEARCH 1.2.1 Advantages of the research: Most studies have characterized the typical liver lesions on US and CT 1.2.2 Disadvantages of the research: ... abscesses are formed during migration of the parasite; and they can be detected as nodular tracts or tunnels on imaging 4.2 VALUE OF US AND CT FINDINGS COMBINED EOSINOPHILS IN DIAGNOSING FASCIOLIASIS...

Ngày tải lên: 01/07/2016, 11:15

24 295 0
PRACTICAL TAXIDERMY A MANUAL OF INSTRUCTION TO THE AMATEUR IN COLLECTING, PRESERVING, AND SETTING UP NATURAL HISTORY SPECIMENS OF ALL KINDS doc

PRACTICAL TAXIDERMY A MANUAL OF INSTRUCTION TO THE AMATEUR IN COLLECTING, PRESERVING, AND SETTING UP NATURAL HISTORY SPECIMENS OF ALL KINDS doc

... of certain modern improvements in modelling and mounting, contains a mass of — for that day — valuable elementary information In fact, the French and German taxidermists were then far in advance ... procure a caged bird, also what is known as a trap-cage, putting the tame bird in the lower part, placing a bunch of blackberries or privet berries in the top part; and hanging the cage against ... muriate of soda (or common salt) and of carbonate of soda The "Natron" is collected once a year, and is used both in Egypt and Syria, as also in Europe, for manufacturing glass and soap, and for bleaching...

Ngày tải lên: 06/03/2014, 13:20

363 612 0
Báo cáo khoa học: "Parotid gland-recovery after radiotherapy in the head and neck region: 36 months follow-up of a prospective clinical study" pdf

Báo cáo khoa học: "Parotid gland-recovery after radiotherapy in the head and neck region: 36 months follow-up of a prospective clinical study" pdf

... head and neck cancer; irradiation, saliva; hyposalivation; parotid gland sparing; recovery Background Sparing salivary glands during radiotherapy (RT) is an important research field in the treatment ... performed radiation treatment of carcinomas of the oral cavity, the oropharynx, and the larynx/ hypopharynx, the sparing of submandibular salivary glands can only be taken into consideration in ... GT, Esclamado RM, Bradford CR, Terrell JE, Gebarski SS, Lichter AS: Parotid gland sparing in patients undergoing bilateral head and neck irradiation: techniques and early results Int J Radiat Oncol...

Ngày tải lên: 09/08/2014, 09:21

25 343 0
Báo cáo y học: " Dimensionality and scale properties of the Edinburgh Depression Scale (EDS) in patients with type 2 diabetes mellitus: the DiaDDzoB study" pot

Báo cáo y học: " Dimensionality and scale properties of the Edinburgh Depression Scale (EDS) in patients with type 2 diabetes mellitus: the DiaDDzoB study" pot

... first scale, a few other, smaller scales were formed, and more and more items became unscalable According to Sijtsma and Molenaar [52, p 81], such a pattern of item clustering is typical for ... exploratory approach) and bifactor models (as a confirmatory approach) provide powerful tools for rigorously examining to what extent the items in a scale together measure a broad attribute in the presence ... statistical analysis and writing the manuscript; GN participated in data collection and preparation, and helped in writing the manuscript; VP participated in the design of the study, and helped in writing...

Ngày tải lên: 11/08/2014, 15:22

19 488 0
Báo cáo y học: " Health status and lifestyle factors as predictors of depression in middle-aged and elderly Japanese adults: a seven-year follow-up of the Komo-Ise cohort study" doc

Báo cáo y học: " Health status and lifestyle factors as predictors of depression in middle-aged and elderly Japanese adults: a seven-year follow-up of the Komo-Ise cohort study" doc

... to interpretation of the results and editing the manuscript All authors contributed the interpretation and discussion of the results They read and approved the final manuscript The authors have ... follow -up Prev Med 2000, 30:371-380 48 Blumenthal JA, Babyak MA, Doraiswamy PM, Watkins L, Hoffman BM, Barbour KA, Herman S, Craighead WE, Brosse AL, Waugh R, Hinderliter A, Sherwood A: Exercise and ... Japan, and a Gerontology and Health Grant from Gunma Prefecture The authors wish to express their gratitude to the mayors and staff of the Village of Komochi and the City of Isesaki for their...

Ngày tải lên: 11/08/2014, 16:23

10 481 0
Increase of microalgal production through symbiosis and scale up mircroalgal cultivation

Increase of microalgal production through symbiosis and scale up mircroalgal cultivation

... bacteria and other microorganisms in nature Research on algae-bacterial interactions in microalgal cultures is an important and quite unexplored area that can provide significant advances for efficient ... They can grow in freshwater, saline/brackish seawater and wastewater with a fast growth rate Microalgae are normally found in aquatic systems, but some algal species can live in a symbiotic relationship ... Eustigmatophyta, Raphidophyta and Phaeophyta (brown algae) 2.6.1 Cyanobacteria Cyanobacteria are prokaryotic algae which are capable of performing plant-like oxygenic photosynthesis, and contain chlorophyll...

Ngày tải lên: 09/09/2015, 11:14

225 824 0
Tài liệu Inequalities in Higher Education and the Structure of the Labour Market pdf

Tài liệu Inequalities in Higher Education and the Structure of the Labour Market pdf

... www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za ... www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za ... Free download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za...

Ngày tải lên: 15/02/2014, 17:20

19 576 0
Tài liệu Báo cáo khoa học: Implication of the glutamine synthetase ⁄glutamate synthase pathway in conditioning the amino acid metabolism in bundle sheath and mesophyll cells of maize leaves doc

Tài liệu Báo cáo khoa học: Implication of the glutamine synthetase ⁄glutamate synthase pathway in conditioning the amino acid metabolism in bundle sheath and mesophyll cells of maize leaves doc

... (AB001385): forward primer, 5Â-GACGGAGCACGAGTTCGAGGC-3Â; reverse primer, 5Â-CTCATATGCCATGATCTCATCG-3Â, L-FNR (AB035644): forward primer, 5Â-ACAACACAAAATGTCAGCTGC AAAA-3Â; reverse primer, 5Â-AAGGCCAAGAAGGAGTC ... (M73831): forward primer, 5Â-CGAAGGTTCCAAGCCTGAAGACC-3Â; reverse primer, 5Â-CTAGCAGAACATAGAAGACAGC-3Â; Fd V (M73828): forward primer, 5Â-TCCAGCCATTACCCGCA GCTAGC-3Â; reverse primer, 5Â-GCTTAGGAGATAAG ... (D49475): forward primer, 5ÂTTGTTCCTTGGGAGGATAGAAAAA-3Â; reverse primer, 5Â-TTGCTTGCAGACAGCATCTCA-3Â; ASN (X82849): forward primer, 5Â-AAAGCTTCATCGCAGCTCGT-3Â; reverse primer, 5Â-CACGACACACACACACACGT-3Â;...

Ngày tải lên: 18/02/2014, 18:20

14 567 0
Tài liệu Báo cáo khoa học: Local stability identification and the role of a key aromatic amino acid residue in staphylococcal nuclease refolding pdf

Tài liệu Báo cáo khoa học: Local stability identification and the role of a key aromatic amino acid residue in staphylococcal nuclease refolding pdf

... W140O and K13 3A] The curves of W14 0A and W140O are nearly linear in terms of intensity All protein concentrations were mgÆmL)1 of the wild-type protein and K13 3A and E142O were 88.45, 84.70, and ... et al Staphylococcal nuclease refolding investigated Two point-mutated proteins, with a single base substitution of alanine for tryptophan (W14 0A) and alanine for lysine (K13 3A) , and two truncated ... Panreac (Barcelona, Spain) Urea was a product of Acros (Pittsburgh, PA, USA) The QuickchangeTM kit containing Pfu DNA polymerase, 10 · reaction buffer and DpnI restriction enzyme was purchased from...

Ngày tải lên: 20/02/2014, 01:20

7 552 0
Tài liệu Báo cáo khoa học: Inorganic pyrophosphatase in the roundworm Ascaris and its role in the development and molting process of the larval stage parasites doc

Tài liệu Báo cáo khoa học: Inorganic pyrophosphatase in the roundworm Ascaris and its role in the development and molting process of the larval stage parasites doc

... (dT)15 primer from Amersham Pharmacia Biotech An A suum adult female worm cDNA expression library was Immunoscreening of a cDNA expression library An adult female worm cDNA expression library was ... bootstrap replicates with the CLUSTALW program (Fig 2) The neighbor-joined trees reveal that animal and fungal PPases including AsPPase represent a separate group from plant and prokaryotic PPases ... assayed in the standard reaction mixture as described above Anti-(mouse rAsPPase) IgG were evaluated for AsPPase-neutralizing activity Recombinant AsPPase proteins or A suum L3 extracts were preincubated...

Ngày tải lên: 20/02/2014, 11:20

13 691 0
Tài liệu Báo cáo khoa học: Analyzing changes of chromatin-bound replication proteins occurring in response to and after release from a hypoxic block of replicon initiation in T24 cells pptx

Tài liệu Báo cáo khoa học: Analyzing changes of chromatin-bound replication proteins occurring in response to and after release from a hypoxic block of replicon initiation in T24 cells pptx

... fragments preferably originating from regions far from matrix attachment points As DNA replication foci are probably located near the nuclear matrix, preferably nonreplicative chromatin fragments ... 3H and 14C radioactivity reoxygenation, incorporation of radioactivity increased strongly within a very short interval and decreased 6–8 h later The profile of [3H]Thd incorporation after reoxygenation ... while replicative chromatin regions remain attached Therefore, preserving the natural chromatin/matrix relations and extracting unbound replication proteins from the nuclei seemed to be more appropriate...

Ngày tải lên: 21/02/2014, 00:20

11 610 0
Tài liệu Báo cáo Y học: Antibacterial and antifungal properties of a-helical, cationic peptides in the venom of scorpions from southern Africa pptx

Tài liệu Báo cáo Y học: Antibacterial and antifungal properties of a-helical, cationic peptides in the venom of scorpions from southern Africa pptx

... [20], parabutoporin and opistoporin were tested on Gramnegative and Gram-positive bacteria and their activity was compared with the activity of melittin and mastoparan (Table 1) Parabutoporin inhibits ... antibacterial than dermaseptin (34 amino acids) [19], peptides consisting of amino acids 7–22 of parabutoporin (an a- helical part having the four amino acids LAKK identical to mastoparan) and of ... peptides isolated from the venom of scorpions indicates that parabutoporin and opistoporin are especially active against Gram-negative bacteria in comparison to Grampositive bacteria Hadrurin [5] is...

Ngày tải lên: 21/02/2014, 15:20

12 598 0
Báo cáo khoa học: The role of helix 8 and of the cytosolic C-termini in the internalization and signal transduction of B1 and B2 bradykinin receptors potx

Báo cáo khoa học: The role of helix 8 and of the cytosolic C-termini in the internalization and signal transduction of B1 and B2 bradykinin receptors potx

... chimera B1NB2 containing all serine and threonine residues critical for B2wt sequestration, in contrast, was able to internalize [3H]DAK at a rate approximately half of the maximal rate (40% after ... Prado GN, Taylor L & Polgar P (1997) Effects of intracellular tryosine residue mutation and carboxyl terminus truncation on signal transduction and internalization of the rat bradykinin B2 receptor ... this process This group also described a strongly increased basal activity for a B2 receptor construct where several C-terminal serine and threonine residues Fig Structural comparison of helix in...

Ngày tải lên: 07/03/2014, 16:20

12 595 0
Báo cáo khoa học: Molecular and functional characterization of a novel splice variant of ANKHD1 that lacks the KH domain and its role in cell survival and apoptosis docx

Báo cáo khoa học: Molecular and functional characterization of a novel splice variant of ANKHD1 that lacks the KH domain and its role in cell survival and apoptosis docx

... of VBARP isoforms in vitro and in vivo: (A) In vitro transcription ⁄ translation of VBARP-L and VBARP-S One microgram of VBARP-L, VBARP-S and vector plasmid was in vitro transcribed ⁄ translated ... Primers used to construct VBARP expression plasmids Isoform Size (kb) Primer sequence VBARP-L 1.9 VBARP-S 1.3 AACAATGCTGACTGATAGCGGAGGA (Forward) TAAGCTACTACGTAAAGAATATATC (Reverse) GATAAGGTACCTGCACTGACACGGATGAAAGC ... Molecular characterization of ANKHD1 splice variant studies blast searches of VBARP revealed that this protein has homology to human ankyrin repeat and KH domain containing 1(ANKHD1) variants, and...

Ngày tải lên: 07/03/2014, 21:20

12 561 0
Báo cáo khoa học: Characterization and cDNA cloning of a clofibrate-inducible microsomal epoxide hydrolase in Drosophila melanogaster potx

Báo cáo khoa học: Characterization and cDNA cloning of a clofibrate-inducible microsomal epoxide hydrolase in Drosophila melanogaster potx

... the supernatant was further centrifuged at 100 000 g for 60 at °C Protein concentrations were determined by Bradford assay using a Protein assay reagent (Bio-Rad) with BSA (Sigma) as a standard ... significant cDNA cloning of DmEH Poly (A) + RNA was extracted from clofibrate-treated larvae using a QuickPrep Micro mRNA Purification Kit (Amersham Pharmacia Biotech), and first-strand cDNA was synthesized ... were examined in T ni [26] JHEH activity was very low at the beginning of the last larval stadium, but it gradually increased, reaching a peak at the wandering stage late in the last larval stadium...

Ngày tải lên: 07/03/2014, 21:20

10 379 0
Báo cáo khoa học: Structural and biological effects of a b2- or b3-amino acid insertion in a peptide Application to molecular recognition of substance P by the neurokinin-1 receptor ppt

Báo cáo khoa học: Structural and biological effects of a b2- or b3-amino acid insertion in a peptide Application to molecular recognition of substance P by the neurokinin-1 receptor ppt

... biological activity, this achiral amino acid can be favourably replaced by sarcosine or proline, whereas a b-II¢ turn constraint around residues and 10 confers antagonist properties [22,23] Therefore, ... conjugate gradient and Newton–Raphson algorithms until the gradient was less than 0.001 kcalÆ ˚ mol)1 A) 1 Conformational grid searches of b-amino acids were initially carried out at intervals of ... receptors [HGly8] NKA(4–10) is as potent as NKA and [Ala8]NKA on rabbit pulmonary artery and rat portal vein, two NK-2 receptor bioassays [43] More recently, the same Ala substitution was reported...

Ngày tải lên: 08/03/2014, 08:20

11 861 0
Báo cáo khoa học: Identification and structural characterization of a sialylated lacto-N-neotetraose structure in the lipopolysaccharide of Haemophilus influenzae pptx

Báo cáo khoa học: Identification and structural characterization of a sialylated lacto-N-neotetraose structure in the lipopolysaccharide of Haemophilus influenzae pptx

... lic 2A, RM118 lpsA and RM118 lgtF before and after treatment with neuraminidase (as indicated by – and +, respectively) The sialylated tetrasaccharide-containing glycoforms are indicated by an asterisk ... data from our laboratory indicate that the ability of acapsular strains of H in uenzae to elaborate sialylated glycoforms can confer serum resistance in model systems In the study of Hood et al ... identification and structural analysis of a Sial-lNnT unit in H in uenzae LPS MATERIALS AND METHODS Bacterial strains and culture conditions The H in uenzae strain RM118 (Rd) is derived from the same source...

Ngày tải lên: 23/03/2014, 21:21

11 579 0
The impact of fodder trees on milk production and income among smallholder dairy farmers in East Africa and the role of research ppt

The impact of fodder trees on milk production and income among smallholder dairy farmers in East Africa and the role of research ppt

... administrators and dairy companies each have a critical role to play in awareness creation that generates demand from farmers for more in- depth training The SCALETM approach draws these various actors ... by international organizations such as ICRAF or national agricultural research institutes such as the National Agricultural Research Organization in Uganda or the Selian Agricultural Research Institute ... numbers of farmers Many of the organizations promoted fodder shrubs primarily for soil conservation In northern Tanzania, data in our records are from 14 organizations in Arusha and Kilimanjaro and...

Ngày tải lên: 24/03/2014, 04:20

55 547 0
GUIDANCE ON GLOBAL SCALE-UP OF THE PREVENTION OF MOTHER-TO-CHILD TRANSMISSION OF HIV potx

GUIDANCE ON GLOBAL SCALE-UP OF THE PREVENTION OF MOTHER-TO-CHILD TRANSMISSION OF HIV potx

... country from sub-Saharan Africa: Botswana In contrast to many antiretroviral therapy programmes, most national PMTCT programmes lacked focused plans and targets for scaling up, and local and global ... 29% in eastern Europe and Latin America to 3% and 2% in western Africa and southern Asia At least eight countries (Argentina, Belize, Botswana, Brazil, Jamaica, Russian Federation, Thailand and ... Western and central Africa: Cameroon, Democratic Republic of the Congo, Côte d’Ivoire and Nigeria • Asia and the Pacific: China and India • Central and eastern Europe: Russian Federation and Ukraine...

Ngày tải lên: 28/03/2014, 09:20

40 348 0

Bạn có muốn tìm thêm với từ khóa:

w