... biochemical analyses reported above A Electron cryomicroscopy and image analysis of the two-dimensional arrays B Fig Analysis of polypeptide composition of grana preparation Comparison of (A) ... monomeric antenna proteins (CP26, CP29 and LHCII monomers) (band 2), and tri4620 meric LHCII (band 3), monomeric (band 4) and dimeric (band 5) PSII cores Bands and contained supramolecular complexes of ... the association of additional LHCII trimers and CP24 which results in the larger supramolecular organizations (megacomplexes) as visualized by Boekema and colleagues [24] The formation and adjustment...
Ngày tải lên: 30/03/2014, 10:20
... Cavalcanti and Oquendo [5] and Berrimi and Messaoudi [6] In their study, Cavalcanti and Oquendo [5] considered the situation where the internal dissipation acts on a part of Ω and the viscoelastic ... for b = and b = and for a wider class of relaxation functions He established a more general decay result, for which the usual exponential and polynomial decay results are just special cases For ... conditions on the initial data to handle the source terms Unfortunately, due to the strong nonlinearities on f1 and f2, the techniques used by Han and Wang [19] and Agre and Rammaha [22] allowed them to...
Ngày tải lên: 21/06/2014, 00:20
Báo cáo nghiên cứu khoa học: " EXPERIMENTAL AND THEORETICAL ANALYSIS OF A CRITICAL CHEMICAL REACTION: DECOMPOSITION OF HYDROGEN PEROXIDE (H2O2)" potx
... mass and energy balances The heat data obtained from the reaction calorimetry were fitted to a mathematical model based on mass and energy balances for a batch reactor coupled by the reaction rate ... peroxide and catalyst concentration and of the initial temperature of the reactor on the reaction rate and the heat flow behavior were evaluated The hydrogen peroxide solution used was a 30% mass ... equation was used because of the explicit influence of pH and catalyst concentration to the kinetics of the reaction The values of the optimized reaction rate constant, k, and the values of the...
Ngày tải lên: 22/07/2014, 03:20
Báo cáo khoa học: "Parotid gland-recovery after radiotherapy in the head and neck region: 36 months follow-up of a prospective clinical study" pdf
... significantly impact on the Dmean of the parotids, and thus on the saliva flow and recovery of parotid gland Keywords head and neck cancer; irradiation, saliva; hyposalivation; parotid gland sparing; ... patients with head and neck cancer leads to a dosedependent change of salivary output and altered salivary composition [9,15,16] Small salivary glands in oral cavity are a part of mucosal target volume ... radiation treatment of carcinomas of the oral cavity, the oropharynx, and the larynx/ hypopharynx, the sparing of submandibular salivary glands can only be taken into consideration in special...
Ngày tải lên: 09/08/2014, 09:21
Báo cáo y học: "A long-term follow-up of a girl with dilated cardiomyopathy after mitral valve replacement and septal anterior ventricular exclusion" docx
... uptake was decreased from the anterior part of the IVS and anterior wall of the LV on cardiac scintigraphy (Arrow: Anterior wall of LV, Arrowhead: Anterior part of IVS) Randas Batista et al described ... associated with heart transplantation in many countries 201Tl uptake Figure wall of the LV from the anterior part and anterior was decreased on cardiac scintigraphy of the IVS 201Tl uptake was ... functional class, who not respond to medical therapy, are candidates for heart transplantation In addition to the shortage of available organs, there are legal, economical, ethical and technical problems...
Ngày tải lên: 10/08/2014, 10:20
Báo cáo y học: " Chemical fingerprinting and quantitative analysis of a Panax notoginseng preparation using HPLC-UV and HPLC-MS" pdf
... [Journal of Pharmaceutical and Biomedical Analysis 41 (2006) 274-279], (B) [Journal of Pharmaceutical and Biomedical Analysis 48 (2008) 1361-1367], (C) [Journal of Pharmaceutical and Biomedical Analysis ... The similarities of chromatograms of 10 samples (n = 3) Additional file 3: PDA Chromatograms standard compounds (A) and a XST injection (C), and total ion current chromatograms of standard compounds ... and quantitative analysis and wrote the manuscript PYS and QS assisted HY to identify the characteristic peaks using HPLC-PDA/ESI-MSn All authors read and approved the final version of the manuscript...
Ngày tải lên: 13/08/2014, 14:20
Soft coral (octocorallia, alcyonacea) diversity and distribution along a latitudinal environmental gradient and the role of their chemical defense against predatory fish the red sea
... collected and analyzed environmental data in the field and the laboratory Hoang and Reinicke identified soft coral in the laboratory Hoang and Sawall analyzed data Hoang wrote the paper Reinicke, Sawall ... Soft Soft coral coral (Sarcophyton (Sarcophyton sp) sp) in in Maqna, Maqna, Saudi Saudi Arabia Arabia 35 Chapter Patterns of soft coral in the Saudi Arabian Red Sea and diversity, if compared ... composition and abundance grouped the sites into three main clusters: representing northern (Maqna and Al-Wajh), central (Yanbu, Jeddah, Rabigh, Mastura and Al-Lith) and southern (Doga and Farasan) reef...
Ngày tải lên: 13/05/2016, 10:16
Effect of unsaturated fatty acid esters of biodiesel fuels on combustion, performance and emission characteristics of a DI diesel engine
... percentage of unsaturation, maximum heat release rate and peak pressure for karanjia biodiesel Biodiesel of karanjia has a lower percentage of unsaturation and has a higher value of maximum heat ... and exhaust gas temperature was observed in case of high unsaturated biodiesel Heat release rate and cumulative heat release rate is lower in case of high- unsaturated biodiesel fuel A general ... properties and combustion parameters "X" variable % of Unsaturation Density Cetane number Heating value Iodine value "Y" variable Start of dynamic injection bTDC Ignition delay Maximum heat release rate...
Ngày tải lên: 05/09/2013, 15:28
An experimental investigation of performance and exhaust emission of a diesel engine fuelled with Jatropha biodiesel and its blends
... Since India has a large waste land area suitable for Jatropha cultivation, it can supply large volume of biodiesel, in fact, nearly half a dozen states of India have reserve a total of 1.72 million ... (R.G.P.V.) Jatropha plant bears fruits from second year of its plantation and the economic yield stabilizes from fourth and fifth year onwards The plant has an average life with effective yield up to ... to range between 0.75 and 2.00 kg /plant and 4.00 and 6.00 MT per hectare per year depending on agro-climatic zone and agriculture practices One hectare of plantation on average soil will give 1.6...
Ngày tải lên: 05/09/2013, 16:11
Optimization of injection timing and injection pressure of a DI diesel engine fueled with preheated rice bran oil
... southern Asia, and it is a staple food for a large part of the world’s human population especially in east, south and south-east Asia, making it the most consumed cereal grain Rice bran oil is extracted ... 349 Deepak Agarwal, Avinash Kumar Agarwal, Performance and emissions characteristics of Jatropha oil (preheated and blends) in a direct injection compression ignition engine, Applied Thermal Engineering ... Nagarajan.G, Mahua (Madhuca indica) seed oil: A source of renewable energy in India, Journal of Scientific and Industrial Research 64, (November 2005): 890 – 896 R Raghu has completed master of...
Ngày tải lên: 05/09/2013, 16:11
Tài liệu tiếng anh Điện tử công suất mạch MERS Loss and rating consideration of a wind energy conversion system with reactive compensation by magnetic energy recovery switch
... generator voltage and the maximum output power can be increased A configuration using a variable series compensation device called a magnetic energy recovery switch (MERS) and a diode bridge has ... device supply voltage and the number of switches, the relative supply rating results The value indicates that with equal voltage utilization of the switches and equal loss per switch, the rating of ... the active rectifier IGBTs will be 24 % higher than for the MERS case The influence of actual switch characteristics and thermal capability has been investigated An average peak junction temperature...
Ngày tải lên: 15/10/2013, 16:11
Inspectors and Teachers perceptions of a good English lesson
Ngày tải lên: 17/10/2013, 10:11
A park like transformation for the study and the control of a nonsinusoidal brushless DC motor
... permanent magnets of the rotor : where L, and M, are the self-inductance and the mutualinductance of the stator coils Since we assume a constant airgap and no saturation, L, and M, are constant ara arb ... on a coordinate transformation and an input transformation as well But the main advantage of the Park transformation is to define an internal state variable which is physically meaningful : that ... The airgap length is constant and large since the magnets are surface mounted and have the same permeability as air As a result, the armature reaction is negligible The magnetic circuit has an...
Ngày tải lên: 03/01/2014, 19:44
The small business start up kit a step by step legal guide, 6 edition
... trademark or a service mark As you can see, a name can wear a bunch of different hats: It can be a trade name, a legal name, and a trademark (or service mark) all in one Legal Name Trade Name ... corporation’s marginal tax rate—the tax rate a corporation would pay on the last dollar of its income—would be 34% Initial rates of corporate taxation are comparatively low (see “Marginal Tax Rates ... Business Start- Up Kit (national and California editions) and Starting and Building a Nonprofit, and has edited such titles as Nolo’s Starting & Running a Successful Newsletter or Magazine; Getting...
Ngày tải lên: 05/01/2014, 14:28
Tài liệu Báo cáo khoa học: Isolation and molecular characterization of a novel D-hydantoinase from Jannaschia sp. CCS1 docx
... subunit molecular mass was also estimated by SDS–PAGE Characterization and comparative analyses of HYDJs and HYDBp The optimal temperature for activity of HYDJs with d-pHPH as substrate was determined ... A novel high-activity D-hydantoinase from Jannaschia sp CCS1 obtain optically pure amino acids, namely chemical and enzymatic syntheses Chemical synthesis gives racemic mixtures of amino acids ... precipitate fraction; sup, supernatant fraction The molecular weight standard (lane M) is indicated on the right A novel high-activity D-hydantoinase from Jannaschia sp CCS1 Fig Purification of HYDBp...
Ngày tải lên: 18/02/2014, 08:20
Tài liệu Báo cáo khoa học: Purification and structural characterization of a D-amino acid-containing conopeptide, conomarphin, from Conus marmoreus docx
... Kumagaye KY, Nakajima K, Watanabe T, Kawai T, Kawakami Y, Niidome T, Sawada K, Nishizawa Y et al (1994) Omega-agatoxinTK containing D-serine at position 46, but not synthetic omega-[L-Ser46]agatoxin-TK, ... assigned and integrated, with concomitant cycles of structure calculations for evaluation of distance and angle constraint violations as well as assignments of additional peaks based on the preliminary ... Inoue A, Kawakami Y, Nishizawa Y, Katayama K & Kuwada M (1995) Isolation and characterization of a peptide isomerase from funnel web spider venom J Biol Chem 270, 16719–16723 Torres AM, Tsampazi...
Ngày tải lên: 18/02/2014, 17:20
Tài liệu Báo cáo khoa học: Spectroscopic characterization of a higher plant heme oxygenase isoform-1 from Glycine max (soybean) ) coordination structure of the heme complex and catabolism of heme docx
... oxyheme appeared at 540 and 579 nm Then, a broad band appeared at around 660 nm, and was maximal 9–12 after initiation of the reaction The spectral features of the final reaction mixture were analogous, ... absorption bands Heme catabolism by HOs of mammals, pathogenic bacteria, cyanobacteria and probably insects is considered to have a similar mechanism, because the characteristic absorption bands of verdoheme ... the formation of CO–verdoheme The 637 nm band disappeared gradually and was replaced by a new broad band with a maximum at approximately 675 nm, identical to the absorption band of free biliverdin...
Ngày tải lên: 19/02/2014, 05:20
Tài liệu Báo cáo khoa học: Structural and biochemical characterization of a human adenovirus 2/12 penton base chimera pptx
... 5¢-CTTTATTTTCAGGGCGCCATGAAGCGCG CAAGACCGTCTGAA-3¢ and a reverse oligomer 5¢-AGCT CGAATTCG GATCCGGTACCTCAGAAGGTAGACAG CAGAACC-3¢ For derivitization with TMR, a Gly-Gly-Cys sequence was introduced at the ... 5¢-CTGCTGTCTACCTTTGGAGGTTGCTGATCCGAA TTCGAG-3¢ (forward) and 5¢-GCTCGAATTCGGATCAG CAACCTCCAAAGGTAGACAGCA-3¢ (reverse) BL21 cells were transformed with the pETM11 construct and grown until a D of 0.8 ... ˚ ˚ area of $ 81 000 A2 with 30% ($ 24 000 A2 ) as contact area Thus, a large amount of the available surface area of the molecule is buried upon pentamerization, increasing the stability of the...
Ngày tải lên: 19/02/2014, 06:20
Tài liệu Báo cáo khoa học: Local stability identification and the role of a key aromatic amino acid residue in staphylococcal nuclease refolding pdf
... Luria–Bertani broth and isopropyl thio-b-d-galactoside were purchased from USB (Cleveland, OH) Salmon testes DNA and some analytical grade chemicals such as EDTA, Tris ⁄ HCl, CaCl2, NaCl and ... 50 mm NaHPO4 ⁄ 200 mm NaCl, pH adjusted to 7.0) at a concentration of 0.5 mgÆmL)1 Spectra were obtained as the average of five successive scans with a bandwidth of 1.0 nm and a scan speed of 20 ... (Mannheim, Germany) Ethanol (> 99%) was obtained from Panreac (Barcelona, Spain) Urea was a product of Acros (Pittsburgh, PA, USA) The QuickchangeTM kit containing Pfu DNA polymerase, 10 · reaction...
Ngày tải lên: 20/02/2014, 01:20
Tài liệu Báo cáo khoa học: Purification and cDNA cloning of a cellulase from abalone Haliotis discus hannai ppt
... TTCTTCAAGGGCTGGCTCCCT CTGATCTAGAGGTACCGGATCC ATCCTCACGAACAAGCAG GATCGCGATGCAGGCCTT GGACGACTACAGCGTCTTCAGTAGA TCCAAACAGTCAGTTTCTTAACCGT Ó FEBS 2003 cDNA cloning of abalone cellulase (Eur J Biochem 270) ... enzyme cDNA cloning Construction of the cDNA library and cloning of cellulase cDNA was achieved as follows: Total RNA was extracted from g of abalone hepatopancreas by the ganidinium thiocyanate-phenol ... cDNA Open and closed boxes indicate translational and untranslational regions, respectively Relative positions of Hd1-DNA, Hd2-DNA, Hd5RACE-DNA, Hd3RACE-DNA, and HdFull-DNA are indicated as solid...
Ngày tải lên: 20/02/2014, 23:20