proteolytic degradation of a amp 946 by neprilysin and other peptidases
Optimization of a window frame by BEM and genetic algorithm
Ngày tải lên :
16/06/2016, 01:11
... introduction of new materials and additional layers of thermal insulation Because of the new regulations in national and international standards, the admissible value of the heat losses of the walls has ... while that of the exterior is mm, and geometry of the frame is approximated by a set of line segments The design variables are contractions, expansions and translations of the air cavities, and ... Optimization of a window frame by BEM and genetic algorithm Optimization of a window frame 565 Małgorzata Kro´l Department of Heat Supply, Ventilation and Dust Removal Technology, Silesian University...
- 17
- 344
- 0
Characterization of a type III secretion system and other virulence associated genes in aeromonas hydrophila
Ngày tải lên :
12/09/2015, 09:42
... reclassified into 14 genomospecies: A hydrophila, A bestiatum, A popoffii, A salmonicida, A caviae, A media, A eucrenophila, A sobria, A jandaei, A veronii, A schubertii, A trota, A encheleia and ... colonization process (Merino et al., 1997) The polar flagellin locus of A caviae shared the highest homology and a similar genetic organization with the flaA and flaB of A salmonicida and V parahaemolyticus ... expression of flaA and flaB 112 Fig IV.10 Effect of ΔlafK, ΔrpoN, ΔexsD and ΔaopN mutants on the expression of lafA1 and lafA2 114 Fig IV.11 Comparative extracellular proteome analysis of AH-1S, ΔaopN,...
- 242
- 490
- 0
Báo cáo khoa học: Specific degradation of H. pylori urease by a catalytic antibody light chain pptx
Ngày tải lên :
07/03/2014, 21:20
... little change At h of incubation (lane 3), the band of the b-subunit became very faint Some new bands between bands and became clearer and several bands around bands and also became darker The band ... monomer In contrast, the intensity of the band (1) (52.2 kDa) became stronger and two new bands (2; 39.2 kDa) and (3; 38.3 kDa) appeared Bands and became darker, whereas the band of the a- subunit showed ... kDa) and (5; 16.5 kDa) were faintly observed immediately after mixing (lane 1) At h of incubation (lane 2), the bands of partially dissociated urease (am b n) became faint as well as the band of...
- 9
- 388
- 0
Báo cáo khoa học: Proteolytic degradation of nitric oxide synthase isoforms by calpain is modulated by the expression levels of HSP90 potx
Ngày tải lên :
23/03/2014, 07:20
... clear aqueous phase Degradation of NOS isozymes by calpain nitrocellulose membrane was probed with monoclonal antiHSP90, nNOS and eNOS sera Assay of calpain activity Calpain activity was assayed ... Results Degradation of NOS isozymes in Ca2+ loaded Jurkat and BAE-1 cells Degradation of NOS isozymes was studied in intact Jurkat and BAE-1 cells, containing nNOS and eNOS, respectively Calpain was ... 2007 The Authors Journal compilation ª 2007 FEBS 6121 Degradation of NOS isozymes by calpain M Averna et al Scheme Binary and ternary complexes generated by HSP90, NOS and calpain CLP, calpain; CST,...
- 12
- 338
- 0
Tài liệu Báo cáo khoa học: Modulation of a-synuclein aggregation by dopamine in the presence of MPTP and its metabolite pptx
Ngày tải lên :
14/02/2014, 19:20
... an important probe for characterization of the nature of the aggregates Characteristic sigmoidal curves of amyloid-type aggregates, Fig Aggregation of a- synuclein (A) Samples were withdrawn after ... 240 h Samples containing MPTP (A and C) and MPP+ (B and D) were analysed by SDS ⁄ PAGE (A and B) on 5–15% crosslinked polyacrylamide gel and western blotting (C and D) (A, B) Lane M, prestained ... substantia nigra is a neuropathological hallmark of Parkinson’s disease This leads to a decreased level of dopamine in the striatum As a result, synaptic transmission is negatively affected in a- synuclein...
- 11
- 754
- 0
Tài liệu Báo cáo khoa học: The chitinolytic system of Lactococcus lactis ssp. lactis comprises a nonprocessive chitinase and a chitin-binding protein that promotes the degradation of a- and b-chitin doc
Ngày tải lên :
18/02/2014, 08:20
... AATCACCA-3Â; reverse primer, 5Â-AGAGGAGAGTTAG AGCCTTACAAGAAGGGTCCAAAGA-3Â) The PCR product was puried, treated with T4 exonuclease to create vector-compatible overhangs and annealed to a prepared ... The Authors Journal compilation ê 2009 FEBS G Vaaje-Kolstad et al Degradation of a- and b-chitin The degradation rates of a- and b-chitin were assayed with LlChi1 8A in the presence or absence of ... The degradation of b-chitin by LlChi1 8A was much more rapid than the degradation of a- chitin Moreover, although about 85% of a- chitin was left after weeks of incubation, all of the b-chitin was...
- 14
- 683
- 0
Báo cáo khoa học: The oleic acid complexes of proteolytic fragments of a-lactalbumin display apoptotic activity pdf
Ngày tải lên :
06/03/2014, 09:22
... [critical aggregate concentration (CAC)] of OA and induce the formation of small and water-soluble OA aggregates All OA complexes displayed apoptotic activity for tumor cells, and the extent of their ... analyzed by far-UV CD measurements, and it was shown that the fragments acquire an enhanced content of a- helical secondary structure upon binding OA The physical and aggregation state of OA at physiological ... chain of a- LA at neutral pH, Lys and Arg residues are clustered at the level of helical segments A, C and D of the native protein, whereas the central region of the protein contains many negatively...
- 11
- 399
- 0
Forest Economic and Environmental Accounting: A pilot study of a first implementation by Statistics Sweden docx
Ngày tải lên :
08/03/2014, 08:20
... systematic way to fit table Acquisition of land and land area There exist no information divided by industries of land area and acquisition or disposal of land At the best such information can be made ... categories, the State, Other public forests, Company forests and Private Tables 1-2 Table 1a and 2a Data on both area and volume for forest and other wooded land are based on data from the National ... construction of holiday camps The split of the total value into land and timber values can be done with information on land values for alternative use of forest land But for most of the land the alternative...
- 48
- 520
- 0
Find-A-Ride: A listing of TLC Licensed Bases by Borough and by Zip Code pdf
Ngày tải lên :
23/03/2014, 10:20
... OCEAN AVENUE 718-676-0126 Paratransit B90605 ALMAZ TRANSPORTATION INC 2313 AVENUE X 718-769-5600 Paratransit B90537 ALTA MEDICAL TRANSPORTATION, INC 2834 CONEY ISLAND AVENUE 212-202-5555 Paratransit ... FIRST CLASS C/L SVC CORP 4980 BROADWAY NEW YORK, NY Last updated Thursday, February 07, 2013 Page of 70 Manhattan Name of Base Street Address Telephone Base Type License # SEAMAN RADIO DISPATCHERS ... GUY'S CAR SVCE 1845 ROCKAWAY PARKWAY DREAMLAND CAR & LIMO.SVC INC 9732 SEAVIEW AVENUE GEORGE TOWN MANAGEMENT INC 919 EAST 107 STREET TRANSIT PVT C/S INC 1417 ROCKAWAY PARKWAY JAH LOVE 582 EAST 88...
- 70
- 615
- 0
Báo cáo khoa học: Quantitative assessment of the glyoxalase pathway in Leishmania infantum as a therapeutic target by modelling and computer simulation pot
Ngày tải lên :
23/03/2014, 13:20
... Sousa Silva et al The glyoxalase pathway in Leishmania infantum Table Glyoxalase I kinetic parameters in Leishmania infantum and other cells Initial rate analysis Glx I Substrate Km (mM) Leishmania ... this parasite by initial rate analysis Using the methylglyoxal glutathione hemithioacetal as substrate, the kinetic parameters for L infantum glyoxalase I, were a Km of 1.85 0.35 mm and a V of ... http://jjj.biochem.sun ac.za/database/silva/index.html free of charge Results and Discussion The potential of the glyoxalase system as a possible therapeutic target relies on its role as the main catabolic pathway...
- 11
- 515
- 0
Báo cáo khoa học: Inhibition of a-synuclein fibrillization by dopamine analogs via reaction with the amino groups of a-synuclein Implication for dopaminergic neurodegeneration pot
Ngày tải lên :
23/03/2014, 15:20
... analogs with a- Syn and some amino acids (A) UV-vis spectra of a- Syn with DA, CA, HQ and Q after reaction for 24 h The a- Syn alone sample was as a control The concentration of a- Syn was 200 lM and ... spectra of the reactions of a- Syn with quinone and DA (A) Overlay of the 1H-15N HSQC spectra of a- Syn (black) and the reaction product of a- Syn and Q (red) (B) Overlay of the 1H-15N HSQC spectra of ... assay The concentration of a- Syn was 200 lM and the fibrillization of a- Syn alone was as a comparison Data were represented as means ± SEM (F) Atomic force microscopic images of a- Syn fibrils a- Syn...
- 12
- 414
- 0
Báo cáo Y học: Potential active-site residues in polyneuridine aldehyde esterase, a central enzyme of indole alkaloid biosynthesis, by modelling and site-directed mutagenesis ppt
Ngày tải lên :
24/03/2014, 04:21
... TGAGAAGTACAATGAGAAGTGTCCGGCAGATA TG-3¢ C17 0A: 5¢-GGCCCTCAAAATGTTCCAGAATT GCTCAGTCGAGGACCTTG-3¢ C-213S: 5¢-CGGTGA AGCGAGCTTATATCTTTTGCAATGAAGATAAAT CATTT-CC-3¢ C25 7A: 5¢GCCAAGGGAAGTTTGCA AGTGCCTGCTTGATATATCAGATT-CA-3¢ ... Germany) and diethylpyrocarbonate (DEPC) was from AppliChem (Darmstadt, Germany) All solvents and chemicals were of analytical grade and obtained from Merck (Darmstadt, Germany), Sigma (Deisenhofen, ... 2890 E Mattern-Dogru et al (Eur J Biochem 269) CCATAGCTTTGGTGGCATGAGTTTGGG-3¢ S8 7A: 5¢-GTTCTTCTTGGCCATAGCTTTGGTGGCATGAG TTTGGG-3¢ H24 4A: 5¢-CAAAGAAGCAGATCATAT GGGAATGCTTTCGCAGCCAAGGG-3¢ D21 6A: 5¢-G...
- 8
- 345
- 0
Báo cáo khoa học: Aspergillus nidulans a-galactosidase of glycoside hydrolase family 36 catalyses the formation of a-galacto-oligosaccharides by transglycosylation doc
Ngày tải lên :
29/03/2014, 21:20
... AglC was tested towards mm pNPaGal, pNPaGalNAc, pNPaAra, pNPaAraf, pNPaGlc, pNPaGlcNAc, pNPaMan, pNPaRha, pNPaXyl, and pNPbGal, and 0.4% galactomannans in 40 mm Na acetate pH 5.0, 0.02% BSA, for ... trehalose, turanose, rafnose, pNPaAra, pNPaAraf, pNPaGal, pNPaGalNAc, pNPbGal, pNPaGlc, pNPaGlcNAc, pNPaMan, pNPaRha and pNPaXyl were purchased from Sigma (St Louis, MO, USA) Galactomannans (Carubin ... mixture of a- and b-galactose from Oryza sativa a- galactosidase [28], N-acetyl -a- galactosamine from Gallus gallus a- N-acetylgalactosaminidase [29] and melibiose from human a- galactosidase [27]...
- 14
- 579
- 0
step-by-step installation of a secure linux web, dns, and mail server 2004
Ngày tải lên :
24/04/2014, 09:18
... a and add a space and a non alpha-numeric character W1r HdYdR# Now we have a password that is private, secret, easily remembered and not easily guessable by any program Openna Linux 1.0 Installation ... operating system and not by an application, it can provide an enormous level of safety A chroot jail "incarcerates" untrusted applications, and acts like a guard, almost literally, for applications ... countermeasure Supported by all Linux and Unix systems, application jails put up a nearly impenetrable barrier between the "jailed" software and the rest of the system And because a jail is enforced by...
- 74
- 437
- 0
Degradation of bacteria escherichia coli by treatment with ar ion beam and neutral oxygen atoms
Ngày tải lên :
18/05/2014, 20:33
... That’s why the SEM image looks rather dim A SEM image of a bacteria treated by Ar ions is shown in Figure The bacteria are badly damaged and definitely not capable of revitalization Materiali ... surface of bacteria as well as between bacteria Namely, the capsule is composed predominantly of chemically bonded water as well as some sugars, proteins and lipids – material that are a bad scatterer ... oxygen plasma in order to assure the removal of any traces of organic contaminants and achieve optimal hydrophilicity A drop of water containing vital bacteria was placed onto the substrate Due to...
- 4
- 201
- 0
báo cáo hóa học:" Quality of Life as reported by children and parents: a comparison between students and child psychiatric outpatients" ppt
Ngày tải lên :
20/06/2014, 15:20
... EXTRA funds and supported by the Norwegian National Council of Mental Health Thanks to all parents and patients participating in the study, and to all personal at the Department of Child and Adolescent ... parametric test Correlations were calculated by Pearson r and Spearman’s rho An alpha level of p < 0.05 indicated statistical significance Results Preliminary analysis The Spearman’s correlations ... to several life domains [32] This concept is partly comprised of positive and negative affect as an emotional appraisal of health and life circumstances, as well as an emotional state that is determined...
- 9
- 494
- 0
The Project Gutenberg eBook, The Adventures of a Forty-niner, by Daniel Knower potx
Ngày tải lên :
28/06/2014, 17:20
... protection of the patron saint of the city The head alcalder of the city was a Castilian Spaniard, a venerable-looking gentleman, white as any Northern man, evidently of Scandinavian descent, who ages ... ruins of what was once its great cathedral The freebooter Morgan is said to have plundered one of its altars of a million of gold and silver, and massacred many of its inhabitants, perpetrating ... have all been candid in your statements, and I shall be the same; I am going to California to deal Faro, the great American gambling game, and I don't care who knows it." Later on in my narrative,...
- 310
- 237
- 0
The Project Gutenberg eBook, The Adventures of a Forty-niner, by Daniel Knower pdf
Ngày tải lên :
28/06/2014, 17:20
... protection of the patron saint of the city The head alcalder of the city was a Castilian Spaniard, a venerable-looking gentleman, white as any Northern man, evidently of Scandinavian descent, who ages ... ruins of what was once its great cathedral The freebooter Morgan is said to have plundered one of its altars of a million of gold and silver, and massacred many of its inhabitants, perpetrating ... have all been candid in your statements, and I shall be the same; I am going to California to deal Faro, the great American gambling game, and I don't care who knows it." Later on in my narrative,...
- 310
- 344
- 0
The Project Gutenberg of The Romance of a Plain Man, by Ellen Glasgow pptx
Ngày tải lên :
28/06/2014, 17:21
... young and delicate and richly dressed, with a quantity of pale brown hair which the rain and wind had beaten flat against her small frightened face At the time she was doubtless an unusually pretty ... whitewashed walls, and its hideous rag carpet—when I think of these vulgar details it is to find that they are softened in my memory by a sense of peace, of shelter, and of warm firelight shadows My mother ... Ultimate Choice Mr JAMES LANE ALLEN'S NOVELS Mr F MARION CRAWFORD'S NOVELS THE ROMANCE OF A PLAIN MAN CHAPTER I IN WHICH I APPEAR WITH FEW PRETENSIONS As the storm broke and a shower of hail rattled...
- 1.1K
- 376
- 0
The Integration of Functions of a Single Variable, by G. H. Hardy pptx
Ngày tải lên :
28/06/2014, 19:20
... where m and n are positive integers, the a s and b’s are constants, and the numerator and denominator have no common factor We shall adopt this expression as the standard form of a rational function ... either algebraical or the sum of an algebraical function and of a finite number of constant multiples of logarithms of algebraical functions All algebraical functions which occur in the integral are ... operations which are always practicable And it has been shown, more generally, that we can always determine by means of such operations whether the integral of any given algebraical function is algebraical...
- 86
- 262
- 1