preferred route for doses gt 50 mg

Báo cáo y học: " Efficacy, safety and tolerability of escitalopram in doses up to 50 mg in Major Depressive Disorder (MDD): an open-label, pilot study" doc

Ngày tải lên : 11/08/2014, 16:23

... which was generally performed over the telephone Patients were advised to taper down the doses (50 mg to 40 mg, 40/45 mg to 30 mg, 30/35 mg to 20 mg and 20/25 mg to 10 mg) at the 32-week or discontinuation ... Increase dose (20 mg to 30 mg or 30 mg to 35 mg) for weeksb Maintain current dose for weeks >8 Increase dose (20 mg to 30 mg or mg increment at 2-weekly intervals) up to 50 mgb a Irrespective ... 20 mg, n (%) (23.8) 30 mg, n (%) (9.5) 35 mg, n (%) (19.0) 40 mg, n (%) (9.5) 50 mg, n (%) (38.1) Dose at the 32-week visit (prior to tapering) 20 mg, n (%) 30 mg, n (%) (23.8) (14.3) 35 mg, ...

9
448
0

Nghiên cứu tối ưu hóa các thông số kỹ thuật đông khô trong quy trình sản xuất thuốc tiêm carboplatin 50 mg

Ngày tải lên : 23/12/2013, 16:47

... 95,870 99, 950 102,760 97, 050 100,240 103,040 101,240 101, 650 102,630 101, 650 101,440 102,000 100, 650 100, 450 102, 250 100,870 101,000 100,590 Trung bình 99,560 100,790 102,210 SD 2, 450 0,683 0,876 ... 22,000 22,000 21,000 22,000 21 ,500 22,000 21,000 21,000 F = 0,339 22,000 21 ,500 22,000 Fc = 3,682 22,000 22,000 21 ,500 21 ,500 22,000 21 ,500 Trung bình 21, 750 21, 750 21,580 SD 0,418 0,418 0,376 ... 102,000 100 ,500 100, 650 102,630 100,800 100,870 101,240 101, 650 99, 650 101, 250 101,440 99,900 Fc= 3,122 99,540 99,860 98,660 F= 3,682 100,870 101, 250 100,560 Trung bình 101,260 100,920 100, 050 SD 1,052...

25
758
0

Báo cáo khoa học: The N-terminal hybrid binding domain of RNase HI from Thermotoga maritima is important for substrate binding and Mg2+-dependent activity pot

Ngày tải lên : 06/03/2014, 22:21

... mM mM mM MgCl2 MnCl2 MgCl2 MnCl2 MgCl2 MnCl2 MgCl2 Speciﬁc activity (U mg) 1) Relative activitya (%) Km (lM) Vmax (U mg) 1) 50 mM KCl 10 mM KCl 50 mM KCl 10 mM KCl 50 mM KCl 10 mM KCl 50 mM NaCl ... TGGGTTTGAGAGCATATGAAGTTGG CAAAAAAATACTAC-3¢ for primer 1, 5¢- CGCATATG GAGACGATGATCGCCTACGTCGATG-3¢ for primer 2, 5¢-ACCGTTAAGCTTTCATAAACATCCTCCTTT-3¢ for primer 3, and 5¢- CGGAATTCTCATGTGTCCAGTTCTG ... length of cm and an A280 value for 0.1% (1 mg mL)1) solution of 1.79 for Tma-RNase HI, 1.75 for Tma-CD, 1.85 for Tma-ND, 1.58 for Tma-W22A, 2.0 for Eco-RNase HI, 0.97 for Sto-RNase HI and 0.56 for...

16
459
0

Báo cáo khoa học: Characterization of the rice carotenoid cleavage dioxygenase 1 reveals a novel route for geranial biosynthesis ppt

Ngày tải lên : 07/03/2014, 03:20

... accompanied by an increased emission of citral [50] The possible synthesis of geranial by tomato CCD1s is now under investigation A novel route for geranial formation Experimental procedures Cloning ... NIST database A novel route for geranial formation 12 13 Acknowledgements This work was supported by the HarvestPlus programme (http://www.harvestplus.org) and by the Deutsche Forschungsgemeinschaft ... Journal compilation ª 2008 FEBS No claim to original German government works 737 A novel route for geranial formation A B C 738 A Ilg et al Fig (A) HPLC analyses of OsCCD1 in vitro assays with synthetic...

12
497
0

solvothermal reactions- an original route for the synthesis of novel materials

Ngày tải lên : 20/03/2014, 13:08

... different structural forms: stable a form or metastable forms (b, c) versus water and the two others solvents (benzene and tetrahydrofurane) can be attributed to the ability to form a stable Mn complex ... appropriated for stabilizing the wurtzite-form (c-MnS) Consequently the solubility of the Mn2+ precursor appears to play also an important role for orienting the stabilization of a stable structural form ... [using as precursors Si(OC2H5)4, Al(OC4Hg)3, Mg( OC2H5)2 and KOCH3] The second was a solvothermal treatment of the resulting gel (50\ P \ 100 MPa, 650 \ T \ 750 °C) using the 2-methoxy-ethanol as solvent...

11
1.5K
0

Báo cáo hóa học: " An alternative route for the synthesis of silicon nanowires via porous anodic alumina masks" potx

Ngày tải lên : 21/06/2014, 01:20

... (XPS) measurements were performed on a PHI 3027 system, by using the Mg Ka (1,253.6 eV) radiation of a twin anode in the constant analyzer energy mode with a pass energy of 50 eV Results and discussion ... solution for 24 h and at a temperature around 1°C, then the oxide layer was removed by using a mixture of chromic and phosphoric acids at 30°C The second anodization step was carried out for h under ... structure Pore structure of the AAO mask-Si before the growth of nanowires molten catalyst has been incorporated within the porous structure of the membrane and before the treatment conditions allow the...

7
471
0

Quick Team-Building Activities for Busy Managers: 50 Exercises That Get Results in Just 15 Minutes_1 potx