... which was generally performed over the telephone Patients were advised to taper down the doses (50 mg to 40 mg, 40/45 mg to 30 mg, 30/35 mg to 20 mg and 20/25 mg to 10 mg) at the 32-week or discontinuation ... Increase dose (20 mg to 30 mg or 30 mg to 35 mg) for weeksb Maintain current dose for weeks >8 Increase dose (20 mg to 30 mg or mg increment at 2-weekly intervals) up to 50 mgb a Irrespective ... 20 mg, n (%) (23.8) 30 mg, n (%) (9.5) 35 mg, n (%) (19.0) 40 mg, n (%) (9.5) 50 mg, n (%) (38.1) Dose at the 32-week visit (prior to tapering) 20 mg, n (%) 30 mg, n (%) (23.8) (14.3) 35 mg, ...
Ngày tải lên: 11/08/2014, 16:23
... 95,870 99, 950 102,760 97, 050 100,240 103,040 101,240 101, 650 102,630 101, 650 101,440 102,000 100, 650 100, 450 102, 250 100,870 101,000 100,590 Trung bình 99,560 100,790 102,210 SD 2, 450 0,683 0,876 ... 22,000 22,000 21,000 22,000 21 ,500 22,000 21,000 21,000 F = 0,339 22,000 21 ,500 22,000 Fc = 3,682 22,000 22,000 21 ,500 21 ,500 22,000 21 ,500 Trung bình 21, 750 21, 750 21,580 SD 0,418 0,418 0,376 ... 102,000 100 ,500 100, 650 102,630 100,800 100,870 101,240 101, 650 99, 650 101, 250 101,440 99,900 Fc= 3,122 99,540 99,860 98,660 F= 3,682 100,870 101, 250 100,560 Trung bình 101,260 100,920 100, 050 SD 1,052...
Ngày tải lên: 23/12/2013, 16:47
Báo cáo khoa học: The N-terminal hybrid binding domain of RNase HI from Thermotoga maritima is important for substrate binding and Mg2+-dependent activity pot
... mM mM mM MgCl2 MnCl2 MgCl2 MnCl2 MgCl2 MnCl2 MgCl2 Specific activity (U mg) 1) Relative activitya (%) Km (lM) Vmax (U mg) 1) 50 mM KCl 10 mM KCl 50 mM KCl 10 mM KCl 50 mM KCl 10 mM KCl 50 mM NaCl ... TGGGTTTGAGAGCATATGAAGTTGG CAAAAAAATACTAC-3¢ for primer 1, 5¢- CGCATATG GAGACGATGATCGCCTACGTCGATG-3¢ for primer 2, 5¢-ACCGTTAAGCTTTCATAAACATCCTCCTTT-3¢ for primer 3, and 5¢- CGGAATTCTCATGTGTCCAGTTCTG ... length of cm and an A280 value for 0.1% (1 mg mL)1) solution of 1.79 for Tma-RNase HI, 1.75 for Tma-CD, 1.85 for Tma-ND, 1.58 for Tma-W22A, 2.0 for Eco-RNase HI, 0.97 for Sto-RNase HI and 0.56 for...
Ngày tải lên: 06/03/2014, 22:21
Báo cáo khoa học: Characterization of the rice carotenoid cleavage dioxygenase 1 reveals a novel route for geranial biosynthesis ppt
... accompanied by an increased emission of citral [50] The possible synthesis of geranial by tomato CCD1s is now under investigation A novel route for geranial formation Experimental procedures Cloning ... NIST database A novel route for geranial formation 12 13 Acknowledgements This work was supported by the HarvestPlus programme (http://www.harvestplus.org) and by the Deutsche Forschungsgemeinschaft ... Journal compilation ª 2008 FEBS No claim to original German government works 737 A novel route for geranial formation A B C 738 A Ilg et al Fig (A) HPLC analyses of OsCCD1 in vitro assays with synthetic...
Ngày tải lên: 07/03/2014, 03:20
solvothermal reactions- an original route for the synthesis of novel materials
... different structural forms: stable a form or metastable forms (b, c) versus water and the two others solvents (benzene and tetrahydrofurane) can be attributed to the ability to form a stable Mn complex ... appropriated for stabilizing the wurtzite-form (c-MnS) Consequently the solubility of the Mn2+ precursor appears to play also an important role for orienting the stabilization of a stable structural form ... [using as precursors Si(OC2H5)4, Al(OC4Hg)3, Mg( OC2H5)2 and KOCH3] The second was a solvothermal treatment of the resulting gel (50\ P \ 100 MPa, 650 \ T \ 750 °C) using the 2-methoxy-ethanol as solvent...
Ngày tải lên: 20/03/2014, 13:08
Báo cáo hóa học: " An alternative route for the synthesis of silicon nanowires via porous anodic alumina masks" potx
... (XPS) measurements were performed on a PHI 3027 system, by using the Mg Ka (1,253.6 eV) radiation of a twin anode in the constant analyzer energy mode with a pass energy of 50 eV Results and discussion ... solution for 24 h and at a temperature around 1°C, then the oxide layer was removed by using a mixture of chromic and phosphoric acids at 30°C The second anodization step was carried out for h under ... structure Pore structure of the AAO mask-Si before the growth of nanowires molten catalyst has been incorporated within the porous structure of the membrane and before the treatment conditions allow the...
Ngày tải lên: 21/06/2014, 01:20
Quick Team-Building Activities for Busy Managers: 50 Exercises That Get Results in Just 15 Minutes_1 potx
... BEFORE: SELECT AN ACTIVITY THAT’S GOOD FOR YOUR TEAM STEP BEFORE: PREPARE FOR YOUR TEAM-BUILDING ACTIVITY STEP DURING: EXPLAIN THE ACTIVITY TO THE TEAM STEP DURING: CHECK FOR UNDERSTANDING BEFORE ... TEAM-BUILDING ACTIVITIES FOR BUSY MANAGERS This page intentionally left blank miller front 7/24/03 3:26 PM Page iii QUICK TEAM-BUILDING ACTIVITIES FOR BUSY MANAGERS 50 Exercises That Get Results ... ACTIVITIES FOR BUSY MANAGERS v miller front 7/24/03 3:26 PM Page vi CHAPTER Connecting: Getting to Know Each Other 50 A DAY IN THE LIFE 52 GOSSIP TIME 54 HUMAN BILLBOARDS 56 MY N.A.M.E A PENNY FOR...
Ngày tải lên: 21/06/2014, 10:20
Quick Team-Building Activities for Busy Managers: 50 Exercises That Get Results in Just 15 Minutes_2 pdf
... work well for the activity For example, see that the dates on the QUICK TEAM-BUILDING ACTIVITIES FOR BUSY MANAGERS miller chap 01 7/24/03 3:33 PM Page pennies are legible, test the markers for any ... materials before the explanation only if you have found that the materials help people understand things better Step During: Check for understanding before beginning People often hesitate to ask for ... ACTIVITIES FOR BUSY MANAGERS 13 miller chap 01 7/24/03 3:33 PM Page 14 answer! Remember, they have never heard the question before, so it may take a few seconds to formulate a response Watch for heads...
Ngày tải lên: 21/06/2014, 10:20
Quick Team-Building Activities for Busy Managers: 50 Exercises That Get Results in Just 15 Minutes_3 pptx
... situations we find ourselves negotiating for time, information, or resources? What implication does this have for us back on the job? You must have at least three teams for this activity to work well If ... topic For example Controversial topics can include gay marriage, abortion, prayer in schools, euthanasia, election finance reform, capital punishment, income tax reform, needle exchange for ... necessary for this activity Which role was easier for you, the speaker or the listener? Why? QUICK TEAM-BUILDING ACTIVITIES FOR BUSY MANAGERS miller chap 03 7/24/03 3:31 PM Page 39 ➤ ➤ ➤ ➤ ➤ ➤ Tips for...
Ngày tải lên: 21/06/2014, 10:20
Quick Team-Building Activities for Busy Managers: 50 Exercises That Get Results in Just 15 Minutes_4 pot
... acronym For example “Hi, I’m Logan L is for Led Zepplin, one of my favorite rock groups O is for Ohio, which is where I live G is for German, the only foreign language I know A is for Aunt ... in bringing in sales For example Some uses for the old machines may be as retro decorative planters; filled with ice and beer for parties; as a container for mixing dye for fabric; as huge, ... follow the rules strictly For example, “L” can be for Loving chocolate, Loving chess, Loving snow, and so forth Be prepared to share your own acronym as an example for the group You may use this...
Ngày tải lên: 21/06/2014, 10:20
Quick Team-Building Activities for Busy Managers: 50 Exercises That Get Results in Just 15 Minutes_5 ppt
... hindering team efforts Individuals are asking the boss to solve their problems for them One children’s puzzle for each small group, preferably with 20 50 pieces A bag (or box or envelope) for each puzzle’s ... reverse roles and repeat For example There is no appropriate example for this activity Ask these questions 80 ➤ ➤ ➤ ➤ A blindfold for each participant A spoon for each participant Popcorn ... have for us back on our jobs? Help them be successful If they forget who gets the ball next, remind them Just be careful not to take over leadership for the group QUICK TEAM-BUILDING ACTIVITIES FOR...
Ngày tải lên: 21/06/2014, 10:20
Quick Team-Building Activities for Busy Managers: 50 Exercises That Get Results in Just 15 Minutes_7 doc
... will force the team to really work on redesigning it Give a 1-minute warning before time is up Impose a purpose or use for the machine, so the teams are then in competition with each other for ... environment? What implications does this have for us back on the job? Encourage the teams to be highly creative in their efforts, to use sound effects, and so forth When selecting the participant who ... change At least one picture from a magazine for each participant Scissors and glue stick for each participant A piece of flipchart paper or other paper for the base of the new picture Here’s how...
Ngày tải lên: 21/06/2014, 10:20
Quick Team-Building Activities for Busy Managers: 50 Exercises That Get Results in Just 15 Minutes_8 potx
... not work, for example)—just listen and thank the others for their help This activity can work for creative idea generation rather than problem solving For example, where should we go for our holiday ... ACTIVITIES FOR BUSY MANAGERS 135 miller chap 07 7/24/03 3:45 PM Page 136 ➤ Tips for success What implications does this have for us back on the job? ➤ Use an identical newspaper for each team ... tape to create a costume for one of their teammates The teams can compete for most original, most funny, most beautiful, and so forth QUICK TEAM-BUILDING ACTIVITIES FOR BUSY MANAGERS miller chap...
Ngày tải lên: 21/06/2014, 10:20
Quick Team-Building Activities for Busy Managers: 50 Exercises That Get Results in Just 15 Minutes_9 pot
... forth this way for minutes Then, have the same pairs the same thing with only one change—each sentence must begin with “Yes, and .” The conversations continue this way for minutes For example ... of the group are critical for their success Individuals are resisting their uniforms or other aspects of “the look” you want Materials you’ll need ➤ One envelope for each team that contains ... various magazines Try for as eclectic a mix as possible for each envelope Be sensitive to racial or gender biases in your group and the pictures Give a 1-minute warning before discussions are...
Ngày tải lên: 21/06/2014, 10:20
Quick Team-Building Activities for Busy Managers: 50 Exercises That Get Results in Just 15 Minutes_10 doc
... activity, 12–13 materials for, outline/format of, 2–3 potential problems, 4, 9, 17–26 preparation for, 8–9 reinforcing learning, 14–15 selection of activity, 7–8 time frame for, 1, 12 types of activities ... Card, 77–79 Penny for Your Thoughts, 58–60 Personal connection activities, 50 71 introduction activities, 56–62, 66–68 personal information-sharing, 52–55, 63–65, 69–71 typical day, 50 51 Popcorn, ... alphabet backwards at the same speed as you did forwards QUICK TEAM-BUILDING ACTIVITIES FOR BUSY MANAGERS 163 miller chap 08 7/24/03 3:48 PM Page 164 For example Z, Y, X, W, V, U, T, S, R, Q,...
Ngày tải lên: 21/06/2014, 10:20
Quick Team-Building Activities for Busy Managers 50 Exercises That Get Results in Just 15 Minutes_1 docx
... work well for the activity For example, see that the dates on the QUICK TEAM-BUILDING ACTIVITIES FOR BUSY MANAGERS miller chap 01 7/24/03 3:33 PM Page pennies are legible, test the markers for any ... materials before the explanation only if you have found that the materials help people understand things better Step During: Check for understanding before beginning People often hesitate to ask for ... ACTIVITIES FOR BUSY MANAGERS 13 miller chap 01 7/24/03 3:33 PM Page 14 answer! Remember, they have never heard the question before, so it may take a few seconds to formulate a response Watch for heads...
Ngày tải lên: 21/06/2014, 14:20
Quick Team-Building Activities for Busy Managers 50 Exercises That Get Results in Just 15 Minutes_3 pptx
... acronym For example “Hi, I’m Logan L is for Led Zepplin, one of my favorite rock groups O is for Ohio, which is where I live G is for German, the only foreign language I know A is for Aunt ... in bringing in sales For example Some uses for the old machines may be as retro decorative planters; filled with ice and beer for parties; as a container for mixing dye for fabric; as huge, ... follow the rules strictly For example, “L” can be for Loving chocolate, Loving chess, Loving snow, and so forth Be prepared to share your own acronym as an example for the group You may use this...
Ngày tải lên: 21/06/2014, 14:20
Quick Team-Building Activities for Busy Managers 50 Exercises That Get Results in Just 15 Minutes_4 docx
... hindering team efforts Individuals are asking the boss to solve their problems for them One children’s puzzle for each small group, preferably with 20 50 pieces A bag (or box or envelope) for each puzzle’s ... reverse roles and repeat For example There is no appropriate example for this activity Ask these questions 80 ➤ ➤ ➤ ➤ A blindfold for each participant A spoon for each participant Popcorn ... have for us back on our jobs? Help them be successful If they forget who gets the ball next, remind them Just be careful not to take over leadership for the group QUICK TEAM-BUILDING ACTIVITIES FOR...
Ngày tải lên: 21/06/2014, 14:20
Quick Team-Building Activities for Busy Managers 50 Exercises That Get Results in Just 15 Minutes_5 pot
... implications does this have for us back on the job? You may want to post a drawing of the star for easy reference Remember, this will help the team (and you may not want to that!) For larger groups (more ... and of diamonds are played for the jack of hearts, none of the teams will get the 11 points; they are lost forever If the of clubs, of spades, and of diamonds are played for the jack of hearts, ... have for our team back on the job? (Do not let your sales force or similar group lose the lesson here Even they need to realize that, internally, they are not in competition with others for resources...
Ngày tải lên: 21/06/2014, 14:20
Quick Team-Building Activities for Busy Managers 50 Exercises That Get Results in Just 15 Minutes_6 docx
... will force the team to really work on redesigning it Give a 1-minute warning before time is up Impose a purpose or use for the machine, so the teams are then in competition with each other for ... environment? What implications does this have for us back on the job? Encourage the teams to be highly creative in their efforts, to use sound effects, and so forth When selecting the participant who ... change At least one picture from a magazine for each participant Scissors and glue stick for each participant A piece of flipchart paper or other paper for the base of the new picture Here’s how...
Ngày tải lên: 21/06/2014, 14:20