... used are as follows: 5¢-AGAGAGAATTCATATGTCAGATT TGTTCAG-3¢ for primer 1; 5¢-TTCCATACCACCACCT GCAACTTGAAGCTC-3¢ for primer 2; 5¢-GTTGCAGGT GGTGGTATGGAACAGCATGCT-3¢ for primer 3; and 5¢-GGCCACTGGATCCAACTACAGCAATTCTCA-3¢ ... [44] and an RNase T1 refolding assay [45] For the protease-coupling assay, chymotrypsin was used as a protease and Suc-ALPF-pNA (Wako Pure Chemical Industries, Ltd., Osaka, Japan) was used as a ... that RCM a- lactalbumin and aprotein substrate of PPIase share a common binding site of FKBP family proteins In order to examine whether NNC-FKBP22 binds to aprotein substrate with similar affinity...
... holo-NPAS2 holo-NPAS2 a p o- N PAS apo-NPAS2 apo-NPAS2 apo-NPAS2 BSA apo-NPAS2 ∆ F (Hz) A Characterization of bHLH-PAS -A of NPAS2 T ime (s) ∆ F (Hz) 1000 500 holo-NPAS2 holo-NPAS2 holo-NPAS2 holo-NPAS2 ... to address this issue Based on resonance Raman spectral studies of His119fiAla, His138fiAla, His171fiAla and Cys170fiAla mutants of the isolated PAS -A domain, it has been suggested that His119 and ... domain significantly affects the spectra of the heme-bound PAS -A domain and appears to assist in stable heme Characterization of bHLH-PAS -A of NPAS2 binding, stabilizing the protein molecule We also...
... FEBS G Vaaje-Kolstad et al Degradation of a- and b-chitin The degradation rates of a- and b-chitin were assayed with LlChi1 8A in the presence or absence of LlCBP3 3A As both chitin variants, and especially ... 5Â-AGAGGAGAGTTAG AGCCTTACAAGAAGGGTCCAAAGA-3Â) The PCR product was puried, treated with T4 exonuclease to create vector-compatible overhangs and annealed to a prepared expression vector (pET30 Xa LIC) provided ... containing a putative transcription regulator (GenBank ID: AAK06047.1), chitinase gene (GenBank ID: AAK06048.1) and gene encoding a family 33 CBP (GenBank ID: AAK06049.1) was amplied FEBS Journal...
... Sorokin A, Anderson I, Galleron N, Candelon B, Kapatral V, Bhattacharyya A, Reznik G, Mikhailova N, Lapidus A et al (2003) Genome sequence of Bacillus cereus and comparative analysis with Bacillus anthracis ... of GAB catalysis have been identified to date [12] which are based either on a single, bifunctional GAB catalyst or on a GAB catalysts pair The available biochemical data on MshB and LpxC are ... C-terminal part folds into a structure consisting of two hydrogen-bonded antiparallel b-strands (b6–b7), an a- helical hairpin (helices a5 , a6 ) and a C-terminal strand (b8) Helix a5 and strand b7 partially...
... Japan) equipped with U-MNIBA2 and U-MWIG2 mirror units (Olympus), a digital charge-coupled device camera C4742-95–12ER (Hamamatsu Photonics, Hamamatsu, Japan), and aquacosmos 2.0 software (Hamamatsu ... 1962–1965 Abe M, Kobayashi Y, Yamamoto S, Daimon Y, Yamaguchi A, Ikeda Y, Ichinoki H, Notaguchi M, Goto K & Araki T (2005) FD, a bZIP protein mediating signals from the floral pathway integrator FT at ... Hayashida M, Fujii T, Hata Y, Hayashi R & Ueda M (2004) Crystallization and preliminary X-ray analysis of carboxypeptidase Y inhibitor IC complexed with the cognate proteinase Acta Crystallogr D 60, 1622–1624...
... standards are indicated on the left in kDa (B) Nucleotide binding assay of His-tagged S64/SBP2 protein Purified His-S64 protein was incubated with GTP-agarose (1), ATP-agarose (2) or Protein A- agarose ... followed by a goat anti-(rabbit IgG) Ig conjugated to alkaline phosphatase (Sigma) at a : 5000 dilution Alkaline phosphatase activity was assayed using 5-bromo-4-chloro-3-indolyl phosphate (Life ... thio-b-D-galactoside (IPTG) The induced protein was affinity-purified using Ni-chelating Sepharose resin (Amersham Pharmacia Biotech.) and used as an antigen to raise polyclonal antisera in rabbits,...
... Tokunaga C, Kuroda S, Tatematsu K, Nakagawa N, Ono Y & Kikkawa U (1998) Molecular cloning and characterization of a novel protein kinase C -interacting proteinwith structural motifs related to ... Potential polyubiquitinated protein carrier RBCK2 37 Hattori N, Kitada T, Matsumine H, Asakawa S, Yamamura Y, Yoshino H, Kobayashi T, Yokochi M, Wang M, Yoritaka A et al (1998) Molecular genetic analysis ... and western blot analysis was carried out using an HRP-conjugated antibody against FLAG, an antibody against S 5a (dilution, : 500), an HRP-conjugated antibody against HA, or a mouse monoclonal...
... and phospholipid -binding proteins Biochim Biophys Acta 1197, 63–93 Carafoli E (2003) The calcium signaling saga: tap water and protein crystals Nature 4, 326–332 Chard PS, Bleakman D, Christakos ... that centrins play a regulatory role by activating or changing the conformation of various target proteins Analyses of amino acid sequences of centrins from different organisms reveal at least ... functional classes also have different structural features: calcium-buffering and calcium-transporting proteins, such as parvalbumin [7] or the Nereis diversicolor sarcoplasmic calciumbinding protein...
... Takara (Kyoto, Japan) and Toyobo (Osaka, Japan), respectively QuikChange XL Site-Directed Mutagenesis Kit was from Stratagene (La Jolla, CA, USA) Construction of plasmids A BamHI site (GAATTC) was ... pGEX-hIZA1 as a template To obtain N-terminal His6 rat IZA, cDNA was PCR amplified with 5¢ primer containing the NcoI site (TACCATGGCTGCCGAGGATG) and 3¢ primer containing the HindIII site (CAAGCTTCAGTCACTCTTCC ... indicated that it contains a transmembrane region (Fig 1A) All these previous reports indicate that IZA1 is a membrane-associated protein However, to which intracellular membrane compartment IZA1...
... tadpole tissues J Biol Chem 250, 8337–8343 Hashizume, K., Miyamoto, T., Ichikawa, K., Yamauchi, K., Kobayashi, M., Sakurai, A. , Ohtsuka, H., Nishii, Y & Yamada, T (1989) Purification and characterization ... retinoic acid formation was examined by incubating the purified xALDH1 with 0.33 mM NAD+ and 30 lM retinal for 1–2 at 24 °C [10] Data are mean ± SEM from at least triplicate determinations.*P ... autoradiography, a labeled protein band of the same size (lanes and in Fig 6), demonstrating that xCTBP/ xALDH1 is capable of binding T3 within the Xenopus cells Table Contents of NAD in rat liver and...
... principle, a given promoter can utilize either the TFIID or SAGA pathway [22] The SAGA pathway is tailored towards TATA-containing promoters, whereas the TFIID pathway plays a greater role at TATA-less ... following additional data are available with the online version of this paper Additional data file is a PDF containing supporting text and figures Additional data file is an Excel workbook that contains ... experiments for any gene Processed data are available in Additional data file A portion of the data from Figure was obtained from [42,48] Raw data are accessible at GEO [60] under series accession...
... CGA ATT CCT TTC TTT CTT TCT TTC TTT CTT TCT TTC TTT CTT TCT TTC TTT TTT TTT TTC TCG AGC CCC-3¢; antisense: 5¢-GGG GCT CGA GAA AAA AAA AAA GAA AGA AAG AAA GAA AGA AAG AAA GAA AGA AAG AAA GAA AGG ... stabilize ARE-containing mRNAs [68] and has been associated with the activation of c-Jun N-terminal kinase (JNK) [69] Similarly, activation of MAP kinase-activated protein kinase has been associated ... formaldehyde gel After transfer on a nylon membrane by capillary blot the RNA was hybridized witha 32P-radiolabelled MARCKS cDNA probe (p809.1) [22], washed and exposed to X-ray film (Kodak AR) with...
... PCaP1 orthologous protein in crude membrane fractions with anti-PCaP1 Lanes and 6, A thaliana; lanes and 7, Raphanus sativus; lanes and 8, Brassica rapa; lanes and 9, B rapa var glabra; lanes and ... pET ⁄ PCaP1, was then directly amplified by PCR witha pair of primers (forward, 5¢-CACCACCACCACCAGATGGGTTACTGGAATTCCA AG-3¢; reverse, 5¢-GTGGTGTTTCATATGTATATCTCCT TCTTAAAGTTAAAC-3¢; italic type ... (radish), Brassica rapa (turnip), Brassica rapa L var glabra Regel (Chinese cabbage) and Brassica oleracea var italica (broccoli)] were purchased from a market Purification of recombinant proteins...
... primer: 5′-GGG TAC CCA CGC GAA TCA C3′), SDHA (forward primer: 5′-TGG GAA CAA GAG GGC ATC TG-3′, reverse primer 5′-CCA CCA CTG CAT CAA ATT CAT G-3′) and UBC (forward primer: 5′-ATT TGG GTC GCG ... M, Bjorling E, Agaton C, Szigyarto CA, Amini B, Andersen E, Andersson AC, Angelidou P, Asplund A, Asplund C, et al: A human protein atlas for normal and cancer tissues based on antibody proteomics ... particularly in the treatment of testicular and ovarian cancer [2] Standard treatment for advanced EOC involves surgical debulking followed by adjuvant chemotherapy witha combination of a platinum...
... CGGTTCACTAAACGAGCTCTGCTGCAGaaaaaatccaaaaaaaatctaaaaaaatcttttaaaa aaccccaaaaaaatttacaaaaaaGTCGACaatgc gcattGTCGACttttttgtaaatttttttggggttttttaaaagatttttttagattttttttg gattttttCTGCAGCAGAGCTCGTTTAGTGAACCG Ccttctccccggcggttagtgctgagagtgc aaaaaatccaaaaaaaatctaaaaaaatcttttaaaaaaccccaaaaaaatttacaaaaaa ... β-gal AR S 5’-aaaaaatccaaaaaaaatctaaaaaaatcttttaaaaaaccccaaaaaaatttacaaaaaa-3’ (3) TOP-β-gal CMV Transcription start site β-gal Relative abundace of β-gal A PABP expression during heat shock recovery ... aaaaaatccaaaaaaaatctaaaaaaatcttttaaaaaaccccaaaaaaatttacaaaaaa Primer with NcoI site Sense ARS with PstI and SalI Antisense ARS with PstI and SalI TOP ARS Acknowledgements This work was supported by funds from a...
... ratios: at a : Fe2+ ⁄ protein ratio, the resonances of Arg20, Asp22 and Asp23 disappeared, and the resonance of Leu21 shifted At a : ratio, the resonances of residues 19 and 44 also disappeared, ... by the small rmsd values calculated for the main chain atoms, ˚ which are not more than 0.2 A (supplementary We have studied the interaction of CyaY with different paramagnetic and diamagnetic ... not cause paramagnetic shifts or influence the transversal relaxation Conversely, two equivalents of the ion cause the shift and disappearance of several signals, without the concomitant appearance...