prbp pdedelta a prenyl binding protein interacting with multiple partners
Tài liệu Báo cáo khoa học: Human enhancer of rudimentary is a molecular partner of PDIP46/SKAR, a protein interacting with DNA polymerase d and S6K1 and regulating cell growth docx
... GCGGGATCCCTCAGCCCATTGGAAGGCACC ATAAGAATGCGGCCGCTCAGCTGTCACTCAGCCGCAGCAG GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAGTCTGAGGTGATAACATTCCC GCGGGATCCCTGGACGGGCAGCCGATGAAG ATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGT ... GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT GCGGGATCCCTCAGCCCATTGGAAGGCACC ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT GCGGGATCCGTGAATAATCTGCACCCTCGA ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT ... AAACTGCAGGATGGCGGACATCTCCCTGGAC AAACTGCAGAAGCTTGATTTTGAATTCTGT AAACTGCAGGATGGCGGACATCTCCCTGGAC AAACTGCAGAAGCTTGATTTTGAATTCTGT GCGAAGCTTCACGATGCCCAAGAAGAAGCCGACGCC GCGGGATCCCGGATGCTGGCAGCGTGGGTTGG...
- 14
- 517
- 0
Báo cáo khoa học: Engineering of monomeric FK506-binding protein 22 with peptidyl prolyl cis-trans isomerase Importance of a V-shaped dimeric structure for binding to protein substrate docx
... used are as follows: 5¢-AGAGAGAATTCATATGTCAGATT TGTTCAG-3¢ for primer 1; 5¢-TTCCATACCACCACCT GCAACTTGAAGCTC-3¢ for primer 2; 5¢-GTTGCAGGT GGTGGTATGGAACAGCATGCT-3¢ for primer 3; and 5¢-GGCCACTGGATCCAACTACAGCAATTCTCA-3¢ ... [44] and an RNase T1 refolding assay [45] For the protease-coupling assay, chymotrypsin was used as a protease and Suc-ALPF-pNA (Wako Pure Chemical Industries, Ltd., Osaka, Japan) was used as a ... that RCM a- lactalbumin and a protein substrate of PPIase share a common binding site of FKBP family proteins In order to examine whether NNC-FKBP22 binds to a protein substrate with similar affinity...
- 11
- 355
- 0
Báo cáo khoa học: Spectroscopic and DNA-binding characterization of the isolated heme-bound basic helix–loop–helix-PAS-A domain of neuronal PAS protein 2 (NPAS2), a transcription activator protein associated with circadian rhythms docx
... holo-NPAS2 holo-NPAS2 a p o- N PAS apo-NPAS2 apo-NPAS2 apo-NPAS2 BSA apo-NPAS2 ∆ F (Hz) A Characterization of bHLH-PAS -A of NPAS2 T ime (s) ∆ F (Hz) 1000 500 holo-NPAS2 holo-NPAS2 holo-NPAS2 holo-NPAS2 ... to address this issue Based on resonance Raman spectral studies of His119fiAla, His138fiAla, His171fiAla and Cys170fiAla mutants of the isolated PAS -A domain, it has been suggested that His119 and ... domain significantly affects the spectra of the heme-bound PAS -A domain and appears to assist in stable heme Characterization of bHLH-PAS -A of NPAS2 binding, stabilizing the protein molecule We also...
- 12
- 360
- 0
Tài liệu Báo cáo khoa học: The chitinolytic system of Lactococcus lactis ssp. lactis comprises a nonprocessive chitinase and a chitin-binding protein that promotes the degradation of a- and b-chitin doc
... FEBS G Vaaje-Kolstad et al Degradation of a- and b-chitin The degradation rates of a- and b-chitin were assayed with LlChi1 8A in the presence or absence of LlCBP3 3A As both chitin variants, and especially ... 5Â-AGAGGAGAGTTAG AGCCTTACAAGAAGGGTCCAAAGA-3Â) The PCR product was puried, treated with T4 exonuclease to create vector-compatible overhangs and annealed to a prepared expression vector (pET30 Xa LIC) provided ... containing a putative transcription regulator (GenBank ID: AAK06047.1), chitinase gene (GenBank ID: AAK06048.1) and gene encoding a family 33 CBP (GenBank ID: AAK06049.1) was amplied FEBS Journal...
- 14
- 683
- 0
Tài liệu Báo cáo khoa học: Crystal structure of the BcZBP, a zinc-binding protein from Bacillus cereus doc
... Sorokin A, Anderson I, Galleron N, Candelon B, Kapatral V, Bhattacharyya A, Reznik G, Mikhailova N, Lapidus A et al (2003) Genome sequence of Bacillus cereus and comparative analysis with Bacillus anthracis ... of GAB catalysis have been identified to date [12] which are based either on a single, bifunctional GAB catalyst or on a GAB catalysts pair The available biochemical data on MshB and LpxC are ... C-terminal part folds into a structure consisting of two hydrogen-bonded antiparallel b-strands (b6–b7), an a- helical hairpin (helices a5 , a6 ) and a C-terminal strand (b8) Helix a5 and strand b7 partially...
- 11
- 710
- 0
Tài liệu Báo cáo khoa học: Specific membrane binding of the carboxypeptidase Y inhibitor IC, a phosphatidylethanolamine-binding protein family member doc
... Japan) equipped with U-MNIBA2 and U-MWIG2 mirror units (Olympus), a digital charge-coupled device camera C4742-95–12ER (Hamamatsu Photonics, Hamamatsu, Japan), and aquacosmos 2.0 software (Hamamatsu ... 1962–1965 Abe M, Kobayashi Y, Yamamoto S, Daimon Y, Yamaguchi A, Ikeda Y, Ichinoki H, Notaguchi M, Goto K & Araki T (2005) FD, a bZIP protein mediating signals from the floral pathway integrator FT at ... Hayashida M, Fujii T, Hata Y, Hayashi R & Ueda M (2004) Crystallization and preliminary X-ray analysis of carboxypeptidase Y inhibitor IC complexed with the cognate proteinase Acta Crystallogr D 60, 1622–1624...
- 10
- 645
- 1
Báo cáo khoa học: A sucrose binding protein homologue from soybean exhibits GTP-binding activity that functions independently of sucrose transport activity pptx
... standards are indicated on the left in kDa (B) Nucleotide binding assay of His-tagged S64/SBP2 protein Purified His-S64 protein was incubated with GTP-agarose (1), ATP-agarose (2) or Protein A- agarose ... followed by a goat anti-(rabbit IgG) Ig conjugated to alkaline phosphatase (Sigma) at a : 5000 dilution Alkaline phosphatase activity was assayed using 5-bromo-4-chloro-3-indolyl phosphate (Life ... thio-b-D-galactoside (IPTG) The induced protein was affinity-purified using Ni-chelating Sepharose resin (Amersham Pharmacia Biotech.) and used as an antigen to raise polyclonal antisera in rabbits,...
- 11
- 343
- 0
Báo cáo khoa học: Accumulation of polyubiquitinated proteins by overexpression of RBCC protein interacting with docx
... Tokunaga C, Kuroda S, Tatematsu K, Nakagawa N, Ono Y & Kikkawa U (1998) Molecular cloning and characterization of a novel protein kinase C -interacting protein with structural motifs related to ... Potential polyubiquitinated protein carrier RBCK2 37 Hattori N, Kitada T, Matsumine H, Asakawa S, Yamamura Y, Yoshino H, Kobayashi T, Yokochi M, Wang M, Yoritaka A et al (1998) Molecular genetic analysis ... and western blot analysis was carried out using an HRP-conjugated antibody against FLAG, an antibody against S 5a (dilution, : 500), an HRP-conjugated antibody against HA, or a mouse monoclonal...
- 11
- 448
- 0
Báo cáo khoa học: What determines the degree of compactness of a calcium-binding protein? pdf
... and phospholipid -binding proteins Biochim Biophys Acta 1197, 63–93 Carafoli E (2003) The calcium signaling saga: tap water and protein crystals Nature 4, 326–332 Chard PS, Bleakman D, Christakos ... that centrins play a regulatory role by activating or changing the conformation of various target proteins Analyses of amino acid sequences of centrins from different organisms reveal at least ... functional classes also have different structural features: calcium-buffering and calcium-transporting proteins, such as parvalbumin [7] or the Nereis diversicolor sarcoplasmic calciumbinding protein...
- 12
- 368
- 0
Báo cáo khoa học: Molecular identification of adrenal inner zone antigen as a heme-binding protein potx
... Takara (Kyoto, Japan) and Toyobo (Osaka, Japan), respectively QuikChange XL Site-Directed Mutagenesis Kit was from Stratagene (La Jolla, CA, USA) Construction of plasmids A BamHI site (GAATTC) was ... pGEX-hIZA1 as a template To obtain N-terminal His6 rat IZA, cDNA was PCR amplified with 5¢ primer containing the NcoI site (TACCATGGCTGCCGAGGATG) and 3¢ primer containing the HindIII site (CAAGCTTCAGTCACTCTTCC ... indicated that it contains a transmembrane region (Fig 1A) All these previous reports indicate that IZA1 is a membrane-associated protein However, to which intracellular membrane compartment IZA1...
- 12
- 351
- 0
Báo cáo Y học: Effect of coenzymes and thyroid hormones on the dual activities of Xenopus cytosolic thyroid-hormone-binding protein (xCTBP) with aldehyde dehydrogenase activity potx
... tadpole tissues J Biol Chem 250, 8337–8343 Hashizume, K., Miyamoto, T., Ichikawa, K., Yamauchi, K., Kobayashi, M., Sakurai, A. , Ohtsuka, H., Nishii, Y & Yamada, T (1989) Purification and characterization ... retinoic acid formation was examined by incubating the purified xALDH1 with 0.33 mM NAD+ and 30 lM retinal for 1–2 at 24 °C [10] Data are mean ± SEM from at least triplicate determinations.*P ... autoradiography, a labeled protein band of the same size (lanes and in Fig 6), demonstrating that xCTBP/ xALDH1 is capable of binding T3 within the Xenopus cells Table Contents of NAD in rat liver and...
- 8
- 405
- 0
Báo cáo y học: "A TATA binding protein regulatory network that governs transcription complex assembly" pdf
... principle, a given promoter can utilize either the TFIID or SAGA pathway [22] The SAGA pathway is tailored towards TATA-containing promoters, whereas the TFIID pathway plays a greater role at TATA-less ... following additional data are available with the online version of this paper Additional data file is a PDF containing supporting text and figures Additional data file is an Excel workbook that contains ... experiments for any gene Processed data are available in Additional data file A portion of the data from Figure was obtained from [42,48] Raw data are accessible at GEO [60] under series accession...
- 16
- 220
- 0
Báo cáo khoa học: Interactions of HIPPI, a molecular partner of Huntingtin interacting protein HIP1, with the specific motif present at the putative promoter sequence of the caspase-1, caspase-8 and caspase-10 genes pdf
... Allowing two substitutions Allowing two substitutions Allowing one substitution AAAGACATG AAAGACAGG AAAGAGATT AAAGAGATG AAAGACATA AAAGACATA AAAGAGAAC AAAGACATA AAAGAAAAG AAACAGATG AAAGAAAAG AAAGAAAAG ... AAAGACATG AGAGACATG AAGGACATG AAATACATG AAAGCCATG AAAGAGATG AAAGACCTG AAAGACACG AAAGACATA + ND ND – – + ND ND ND + – – – – + – + – 0.25 1.5 p=0.01 60_HI 60M_HI Fig The caspase-1 gene upstream ... AAAGACATG 6.00E+007 4.00E+007 2.00E+007 0.00E+000 0.00 0.01 0.02 0.03 0.04 10 0.00 0.05 AAGGACATG AGAGACATG AAAGACCTG AAAGACACG AAAGACATA 12 0.02 0.06 0.04 [DNA]µM I 0.08 [DNA]µM II C AAAGAGATG...
- 14
- 393
- 0
Báo cáo khoa học: The 3¢-UTR of the mRNA coding for the major protein kinase C substrate MARCKS contains a novel CU-rich element interacting with the mRNA stabilizing factors HuD and HuR ppt
... CGA ATT CCT TTC TTT CTT TCT TTC TTT CTT TCT TTC TTT CTT TCT TTC TTT TTT TTT TTC TCG AGC CCC-3¢; antisense: 5¢-GGG GCT CGA GAA AAA AAA AAA GAA AGA AAG AAA GAA AGA AAG AAA GAA AGA AAG AAA GAA AGG ... stabilize ARE-containing mRNAs [68] and has been associated with the activation of c-Jun N-terminal kinase (JNK) [69] Similarly, activation of MAP kinase-activated protein kinase has been associated ... formaldehyde gel After transfer on a nylon membrane by capillary blot the RNA was hybridized with a 32P-radiolabelled MARCKS cDNA probe (p809.1) [22], washed and exposed to X-ray film (Kodak AR) with...
- 16
- 754
- 0
Báo cáo khoa học: A hydrophilic cation-binding protein of Arabidopsis thaliana, AtPCaP1, is localized to plasma membrane via N-myristoylation and interacts with calmodulin and the phosphatidylinositol phosphates PtdIns(3,4,5)P3 and PtdIns(3,5)P2 pptx
... PCaP1 orthologous protein in crude membrane fractions with anti-PCaP1 Lanes and 6, A thaliana; lanes and 7, Raphanus sativus; lanes and 8, Brassica rapa; lanes and 9, B rapa var glabra; lanes and ... pET ⁄ PCaP1, was then directly amplified by PCR with a pair of primers (forward, 5¢-CACCACCACCACCAGATGGGTTACTGGAATTCCA AG-3¢; reverse, 5¢-GTGGTGTTTCATATGTATATCTCCT TCTTAAAGTTAAAC-3¢; italic type ... (radish), Brassica rapa (turnip), Brassica rapa L var glabra Regel (Chinese cabbage) and Brassica oleracea var italica (broccoli)] were purchased from a market Purification of recombinant proteins...
- 16
- 424
- 0
Báo cáo khoa học: IMP1 interacts with poly(A)-binding protein (PABP) and the autoregulatory translational control element of PABP-mRNA through the KH III-IV domain pdf
... EcoRI-T7-aaaaaatccaaaaaaaatctaaaaaaatcttttaaaaaa ccccaaaaaaatttacaaaaaa-BamHI EcoRI-T7-tccaaaaaaaatctaaaaaaatcttttaaaaaa ccccaaaaaaattt-BamHI EcoRI-T7-aaaaaatccaaaaaaaatct-BamHI EcoRI-T7-tctaaaaaaatcttttaaaaaacccc-BamHI ... EcoRI-T7-ccccaaaaaaatttacaaaaaatc-BamHI EcoRI-T7-ccccaaaaaaattt-BamHI EcoRI-T7-aaaaaaaaaaaaaaaaaaaaaaaaaaaaaa aaaaaaaaaaaaaaaaaaaa-BamHI ¨ AARS-4 ¨ AARS-L ¨ AARS-C ¨ AARS-R ¨ AARS-S Poly (A) 50 FEBS Journal ... BamHI-gtggacatcccccttcgg BamHI-gctgctccctatagctcc EarI-catgaaccccagtgcc EarI-catggatgttataaagggc EarI-catgggacgatttaagtct EarI-catggaacagatgaaacaa EarI-catggagcgccaggctcac EarI-catgaacaagctttacatcg EarI-catggtggacatcccccttcgg...
- 13
- 466
- 0
Báo cáo hóa học: " Expression of the RNA-binding protein RBM3 is associated with a favourable prognosis and cisplatin sensitivity in epithelial ovarian cancer" ppt
... primer: 5′-GGG TAC CCA CGC GAA TCA C3′), SDHA (forward primer: 5′-TGG GAA CAA GAG GGC ATC TG-3′, reverse primer 5′-CCA CCA CTG CAT CAA ATT CAT G-3′) and UBC (forward primer: 5′-ATT TGG GTC GCG ... M, Bjorling E, Agaton C, Szigyarto CA, Amini B, Andersen E, Andersson AC, Angelidou P, Asplund A, Asplund C, et al: A human protein atlas for normal and cancer tissues based on antibody proteomics ... particularly in the treatment of testicular and ovarian cancer [2] Standard treatment for advanced EOC involves surgical debulking followed by adjuvant chemotherapy with a combination of a platinum...
- 12
- 531
- 0
Tài liệu Báo cáo khoa học: Identification of Ewing’s sarcoma protein as a G-quadruplex DNA- and RNA-binding protein ppt
... ACA G) and EWS reverse d(CGC TCG AGT CAC TAG TAG GGC CGA TCT CTG C), for pGEX–EWS; EAD forward d(CGG AAT TCA TGG CGT CCA CGG ATT ACA G) and EAD reverse d(CGC TCG AGT CAT CCG GAA AAT CCT CCA GAC ... pGEX–EAD; RGG1 forward d(CGG AAT TCC CAG GAG AGA ACC GGA GCA T) and RGG1 reverse d(CGC TCG AGT CAA TCA AGA TCT GGT CCT TCA TCC ATG G), for pGEX–RGG1; RRM– RGG2–ZnF forward d(CGG AAT TCC TAG GCC CAC ... methyltransferase and toward the Ewing sarcoma protein and a peptide Proteins 61, 164–175 48 Raman B, Guarnaccia C, Nadassy K, Zakhariev S, Pintar A, Zanuttin F, Frigyes D, Acatrinei C, Vindigni A, ...
- 11
- 786
- 0
Tài liệu Báo cáo khoa học: Expression of poly(A)-binding protein is upregulated during recovery from heat shock in HeLa cells doc
... CGGTTCACTAAACGAGCTCTGCTGCAGaaaaaatccaaaaaaaatctaaaaaaatcttttaaaa aaccccaaaaaaatttacaaaaaaGTCGACaatgc gcattGTCGACttttttgtaaatttttttggggttttttaaaagatttttttagattttttttg gattttttCTGCAGCAGAGCTCGTTTAGTGAACCG Ccttctccccggcggttagtgctgagagtgc aaaaaatccaaaaaaaatctaaaaaaatcttttaaaaaaccccaaaaaaatttacaaaaaa ... β-gal AR S 5’-aaaaaatccaaaaaaaatctaaaaaaatcttttaaaaaaccccaaaaaaatttacaaaaaa-3’ (3) TOP-β-gal CMV Transcription start site β-gal Relative abundace of β-gal A PABP expression during heat shock recovery ... aaaaaatccaaaaaaaatctaaaaaaatcttttaaaaaaccccaaaaaaatttacaaaaaa Primer with NcoI site Sense ARS with PstI and SalI Antisense ARS with PstI and SalI TOP ARS Acknowledgements This work was supported by funds from a...
- 19
- 596
- 0
Tài liệu Báo cáo khoa học: Understanding the binding properties of an unusual metal-binding protein ) a study of bacterial frataxin pdf
... ratios: at a : Fe2+ ⁄ protein ratio, the resonances of Arg20, Asp22 and Asp23 disappeared, and the resonance of Leu21 shifted At a : ratio, the resonances of residues 19 and 44 also disappeared, ... by the small rmsd values calculated for the main chain atoms, ˚ which are not more than 0.2 A (supplementary We have studied the interaction of CyaY with different paramagnetic and diamagnetic ... not cause paramagnetic shifts or influence the transversal relaxation Conversely, two equivalents of the ion cause the shift and disappearance of several signals, without the concomitant appearance...
- 12
- 704
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008