post transcriptional regulation of proto oncogene c fms in breast cancer

Báo cáo khoa học: "Regulation of the erm(C) Gene in Staphylococci from Reservoir with Different Usage of Macrolides" docx

Báo cáo khoa học: "Regulation of the erm(C) Gene in Staphylococci from Reservoir with Different Usage of Macrolides" docx

... primers RegermC-1 (5'-TAAACCGTGTGCTCTACGA C- 3') and RegermC-2 (5'-CCTTTTCCTGAGCCGATTTC-3') Origins of strains are indicated as well as Shine-Delgano (SD-1 and SD-2) sequences, sequence of the leader ... ATCAGCACAGTTCATTATCAACCAAACAAAAAATAAGTGGTTATAATGAAT ATCAGCACAGTTCATTATCAACCAAACAAAAAATAAGTGGTTATAATGAAT ATCAGCACAGTTCATTATCAACCAAACAAAAAATAAGTGGTTATAATGAAT ATCAGCACAGTTCATTATCAACCAAACAAAAAATAAGTGGTTATAATGAAT ... No positive amplicons were obtained (data not shown) A set of PCR primers (RegermC-1: 5'-TAAACCGTGTGCTCTACGAC-3' and RegermC-2: 5'-CCTTTTCCTGAGCCGATTTC3') was constructed spanning the regulatory...

Ngày tải lên: 12/08/2014, 15:21

4 248 0
Transcriptional regulation of the inducible costimulator (ICOS) in t cells

Transcriptional regulation of the inducible costimulator (ICOS) in t cells

... GCA TGC ATC CAT C3 ′; antisense 5′-CCC AAG CTT AGT GCT CAA AAG TGT CAG-3′ (288-bp product); a pair spanning a 259-bp stretch of icos 3′UTR (ICOS E), 5′-GAT GTT CCC ATA TTC TCC-3′ and 5′-CCA GGA GAA ... attenuated ICOS/B7-H2 signalling in CD28 KO mice is defective ICOS up -regulation To address the issue of the costimulatory capacity of ICOS in the absence of CD28, mice doubly deficient in CD28 and ICOS ... roquin Enforced expression of wild-type but not a sanroque mutant form of roquin accelerated the decay of ICOS mRNA in a T cell line Collectively, our findings indicate that during the initial TCR/CD28-mediated...

Ngày tải lên: 13/09/2015, 19:52

151 308 0
In vivo and in vitro study on potential combination therapy of COL 3 and tamoxifen in breast cancer a pilot study

In vivo and in vitro study on potential combination therapy of COL 3 and tamoxifen in breast cancer a pilot study

... Protein binding displacement interactions has gained prominence as a possible mechanism of drug-drug interaction In the case of plasma protein binding, most displacement of drugs from plasma binding ... one of the most common mechanisms by which pharmacodynamic interactions occur Not all drug-drug interactions are hazardous, and some synergistic interactions when they occur can be of clinical ... antagonistic effects on human cancer cell lines when given together, an in vitro investigation would be conducted to examine the effects of COL-3 and tamoxifen, in single agent or in combination against...

Ngày tải lên: 09/10/2015, 11:24

134 360 0
Tài liệu Báo cáo khoa học: The splicing factor ASF/SF2 is associated with TIA-1-related/ TIA-1-containing ribonucleoproteic complexes and contributes to post-transcriptional repression of gene expression doc

Tài liệu Báo cáo khoa học: The splicing factor ASF/SF2 is associated with TIA-1-related/ TIA-1-containing ribonucleoproteic complexes and contributes to post-transcriptional repression of gene expression doc

... on speci c interactions between cis-acting elements mainly localized in the UTRs of the transcript and the trans-acting factors (RNA-binding proteins and noncoding regulatory RNAs) that bind to ... control of the expression of mRNAs coding for proteins such as cytokines or proto- oncogenes Such regulation allows a very fast modification of the protein pool in response to speci c stimuli Indeed, ... are components of a ribonucleoproteic complex including tumour necrosis factor-a mRNA, a prototype of ARE-containing mRNAs, in macrophage cell extracts [45] Similar to TIAR, all three proteins...

Ngày tải lên: 16/02/2014, 15:20

19 666 0
Tài liệu Báo cáo Y học: Intracellular localization and transcriptional regulation of tumor necrosis factor (TNF) receptor-associated factor 4 (TRAF4) pdf

Tài liệu Báo cáo Y học: Intracellular localization and transcriptional regulation of tumor necrosis factor (TNF) receptor-associated factor 4 (TRAF4) pdf

... homogenous cytoplasmic staining was observed In contrast, in transfected cells that have cell–cell contacts, a significant local increase of T4–GFP was observed in the contact sites Analysis of the ... transfection In one cell GFP fluorescence in the indicated area (white box) of the cell was bleached repetitively for the indicated time (bleaching cell ÔBÕ) (A) Finally, the average fluorescence intensity ... cancer cell line MCF-7 and the human epidermal carcinoma cell line A431 were obtained from the American Type Culture Collection (Rockville, MD, USA) The IKKc-deficient Jurkat cell line and respective...

Ngày tải lên: 21/02/2014, 15:20

11 468 0
Báo cáo Y học: Transcriptional regulation of erythropoiesis Fine tuning of combinatorial multi-domain elements ppt

Báo cáo Y học: Transcriptional regulation of erythropoiesis Fine tuning of combinatorial multi-domain elements ppt

... reported in carriers of point mutations within the b-globin promoter CACC box [57,59] This may indicate a role for EKLF in silencing c- globin expression, or in the c- to b-globin switching process ... three C- terminal zinc finger domains of mouse EKLF Each finger includes three key amino acids that form sequence-speci c contacts with three DNA residues The N-terminal of the protein is rich in proline ... cells bHLH SCL GATA-2 Zinc finger Motifs Gene Phenotype of genomic disruption Table Effects of Hematopoietic/Erythroid transcription factors TTCC(A > T)GGAA CACC CACC GC rich – T/AGATAA/G TAACGG T/AGATAA/G...

Ngày tải lên: 08/03/2014, 22:20

12 571 0
Báo cáo khoa học: E2A participates in a fine control of pre-mature B-cell apoptosis mediated by B-cell receptor signaling via transcriptional regulation of survivin, IAP2 and caspase-8 genes pot

Báo cáo khoa học: E2A participates in a fine control of pre-mature B-cell apoptosis mediated by B-cell receptor signaling via transcriptional regulation of survivin, IAP2 and caspase-8 genes pot

... 5¢-CTGTTTTTACCACCAAATCG-3¢ and antisense primer 5¢-CAACTTGTTGCTTGTTGGAT-3¢) and SIRT2 (sense primer 5¢-ATGTCCCTCATGGGCTTCGG-3¢ and antisense primer 5¢-TCACGGCTCTTTGTCGTCCC-3¢) The chicken glyceraldehyde ... stimulation via complex transcriptional regulation of a number of genes encoding BCR signaling-related factors, B cell-speci c factors, transcription factors and apoptosis-related factors, indicating that ... transduction of the activated signal into the caspase cascade pathway However, understanding of the participation of most B cell-speci c factors in the apoptotic process has remained elusive Lack of...

Ngày tải lên: 16/03/2014, 04:20

11 349 0
Báo cáo khoa học: Involvement of NF-jB subunit p65 and retinoic acid receptors, RARa and RXRa, in transcriptional regulation of the human GnRH II gene pot

Báo cáo khoa học: Involvement of NF-jB subunit p65 and retinoic acid receptors, RARa and RXRa, in transcriptional regulation of the human GnRH II gene pot

... Mut10 ACTAAGCTTAAAAGGGGACTTCTCTGGCATGGTTCAGGTTTGGAGGCACCTGGGA ACTAAGCTTAAAAGGGGACTTCTCTGGCATGGTTCCTGGGTGGAGGCACCTG ACTAAGCTTAAAAGGGGACTTCTCTGGCATGGGGCAGGGGTGGAGGCAC ACTAAGCTTAAAAGGGGACTTCTCTGGCAGTGTTCAGGGGTGGAGG ... ACTAAGCTTAAAAGGGGACTTCTCTGGCAGTGTTCAGGGGTGGAGG ACTAAGCTTAAAAGGGGACTTCTCTGTAATGGTTCAGGGGTGG ACTAAGCTTAAAAGGGGACTTCTAGGGCATGGTTCAGGGG ACTAAGCTTAAAAGGGGACTGATCTGGCATGGTTCAGGGG ACTAAGCTTAAAAGGGGCATTCTCTGGCATGGTTCAGGGG ACTAAGCTTAAAAGTTGACTTCTCTGGCATGGTTCAGGGG ... corepressor Complex by the receptor, which then recruits a series of coactivator proteins, such as steroid receptor coactivator (SRC-1), glucocorticoid receptor interacting protein (GRIP1), activator of...

Ngày tải lên: 16/03/2014, 10:20

12 399 0
Báo cáo khoa học: Transcriptional regulation of the desferrioxamine gene cluster of Streptomyces coelicolor is mediated by binding of DmdR1 to an iron box in the promoter of the desA gene doc

Báo cáo khoa học: Transcriptional regulation of the desferrioxamine gene cluster of Streptomyces coelicolor is mediated by binding of DmdR1 to an iron box in the promoter of the desA gene doc

... CGGGTGGCCGCCAAACTCG AGGAAGCGCGGTCAAGGGAGTCTC CGCAAGGCGCTGGCCGAGTTCA TGTGCAGCAGCGGGACGTAGTAGG GGAATTCCGCGCGCGGGTCTGGCTTCA RT-PCR RT-PCR RT-PCR RT-PCR RT-PCR RT-PCR RT-PCR RT-PCR PCR cloning of the ... desA promoter Pr O6 hrdB-5 hrdB-3 CGGGATCCCGGTACTGCTCCGCGGTGGTGTCGTT GCGATCGCTGCCACTGC GCCGCCGCGCCAAGAACCA CCAGCGGCGTGTGCAGCGAGAT 1120 Primer extension RT-PCR RT-PCR FEBS Journal 274 (2007) 1110–1122 ... containing the apramycin resistance gene [aac(3)IV] and oriT was used as template The mutant was constructed using the oligonucleotides 5¢-acccc tctcggaccgtccccaccggaggacccccccatgATTCCGGGGATC 1118 This...

Ngày tải lên: 16/03/2014, 11:20

13 456 0
Báo cáo sinh học: " Genome structure and transcriptional regulation of human coronavirus NL63" docx

Báo cáo sinh học: " Genome structure and transcriptional regulation of human coronavirus NL63" docx

... CGC CGG CGU AGA AGG CUA CUC CUG CUU UUA UUG UCA UCC UCG UCU AGC AGU ACA ACC ACG ACU CCA CCC CCG CCU GCA GCC GCG GCU GGA GGC GGG GGU GUA 0.62b 1.07 1.1 6c 0.46 1.17 1.17 0.70 1.97 4.01 1.30 0.74 1.28 ... – ACT ACG GTG ATT ACC AAC ATC AAT ATA; ORF3 – 4L3' – CAA GCA ACA CGA CCT CTA GCA GTA AG; E gene – EL3' – TAT TTG CAT ATA ATC TTG GTA AGC; M gene – ML3' – GAC CCA GTC CAC ATT AAA ATT GAC A; N ... AGC GT) and 3' primer MHV_UTR-B3' (TGC CAC AAC CTT CTC TAT CTG TTA T) Labeling of the probes was done in a standard PCR reaction with specific 3' primers (N3PCR1 and MHV_UTRB3') in presence of...

Ngày tải lên: 18/06/2014, 22:20

11 398 0
báo cáo hóa học:" Genome structure and transcriptional regulation of human coronavirus NL63" ppt

báo cáo hóa học:" Genome structure and transcriptional regulation of human coronavirus NL63" ppt

... CGC CGG CGU AGA AGG CUA CUC CUG CUU UUA UUG UCA UCC UCG UCU AGC AGU ACA ACC ACG ACU CCA CCC CCG CCU GCA GCC GCG GCU GGA GGC GGG GGU GUA 0.62b 1.07 1.1 6c 0.46 1.17 1.17 0.70 1.97 4.01 1.30 0.74 1.28 ... – ACT ACG GTG ATT ACC AAC ATC AAT ATA; ORF3 – 4L3' – CAA GCA ACA CGA CCT CTA GCA GTA AG; E gene – EL3' – TAT TTG CAT ATA ATC TTG GTA AGC; M gene – ML3' – GAC CCA GTC CAC ATT AAA ATT GAC A; N ... AGC GT) and 3' primer MHV_UTR-B3' (TGC CAC AAC CTT CTC TAT CTG TTA T) Labeling of the probes was done in a standard PCR reaction with specific 3' primers (N3PCR1 and MHV_UTRB3') in presence of...

Ngày tải lên: 20/06/2014, 04:20

11 449 0
báo cáo hóa học:" Transcriptional regulation of bone formation by the osteoblast-specific transcription factor Osx Chi Zhang" pptx

báo cáo hóa học:" Transcriptional regulation of bone formation by the osteoblast-specific transcription factor Osx Chi Zhang" pptx

... mechanisms: activates the expression of Wnt antagonist Dkk1 and disrupts Tcf binding to DNA to inhibit the transcriptional activity of βcatenin/Tcf sion in C2 C12 mesenchymal cells inhibited cell ... Osx can disrupt Tcf binding to DNA, providing a likely mechanism for the inhibition by Osx of β-catenin transcriptional activity The transcription factor Tcf is known to interact with βcatenin ... DNA-binding domain of Osx is located at its C terminus containing three Z-finger domains and there is a proline-rich region (PRR) close to N terminus in Osx perichondrium, and mesenchymal condensations...

Ngày tải lên: 20/06/2014, 04:20

8 491 0
Báo cáo y học: "Transcriptional regulation of collagenase (MMP-1, MMP-13) genes in arthritis: integration of complex signaling pathways for the recruitment of gene-specific transcription factor" ppt

Báo cáo y học: "Transcriptional regulation of collagenase (MMP-1, MMP-13) genes in arthritis: integration of complex signaling pathways for the recruitment of gene-specific transcription factor" ppt

... JA, Vincenti MP, Coon CI, Barchowsky A, Brinckerhoff CE: Interleukin-1 induction of collagenase (matrix metalloproteinase 13) gene expression in chondrocytes requires p38, c- Jun N-terminal kinase, ... Williams-Skipp C, Scheinman RI: Mapping of glucocorticoid receptor DNA binding domain surfaces contributing to transrepression of NF-kappa B and induction of apoptosis J Biol Chem 2001, 276:2329-2332 ... nuclear factor kappaB: differential regulation of collagenase and collagenase Arthritis Rheum 2000, 43:801-811 Vincenti MP, Coon CI, Mengshol JA, Yocum S, Mitchell P, Brinckerhoff CE: Cloning of...

Ngày tải lên: 09/08/2014, 03:24

8 436 0
Transcriptional regulation of protein complexes in yeast potx

Transcriptional regulation of protein complexes in yeast potx

... YBR00 9c_ HHF1 comment gcgn{10}aac|gttn{10}cgc 4.38 gcgn{9}gaa|ttcn{9}cgc 3.06 attn{2}gcg|cgcn{2}aat 2.43 cgan{9}aac|gttn{9}tcg 2.12 cgcn{10}gaa|ttcn{10}gcg 1.38 gcgn{8}aga|tctn{8}cgc 1.24 cgan{8}gaa|ttcn{8}tcg ... cgan{8}gaa|ttcn{8}tcg 1.22 gaan{8}aac|gttn{8}ttc 1.04 ctgn{7}cgc|gcgn{7}cag 0.72 cgan{10}acg|cgtn{10}tcg 0.64 cgtn{9}ttc|gaan{9}acg 0.08 cgtn{11}cgc|gcgn{11}acg 1.53 YBL002w_HTB2 YNL03 1c_ HHT2 reviews ... protein complexes in yeast: mining large scale protein-protein interaction screens Bioinformatics 2003, 19:1901-1908 Manke T, Bringas R, Vingron M: Correlating protein-DNA and protein-protein interaction...

Ngày tải lên: 09/08/2014, 20:20

22 176 0
Báo cáo y học: " Transcriptional regulation of metastatic [Id]entity by KLF17" pdf

Báo cáo y học: " Transcriptional regulation of metastatic [Id]entity by KLF17" pdf

... downregulation of E-cadherin occurs through the direct binding of Id1 protein to the trans­ ription c factor HEB (HELA E-box binding factor), which prevents HEB from accessing the E-cadherin promoter ... these screens should be carried out in models other than breast cancer, as distinct transcription factors might play a role in the regulation of invasion and metastasis in different cancer types ... model in which loss of KFL17 leads to induction of ID1, which could promote primary tumor vascularization via VEGF production and initiate invasion through EMT-associated processes, including loss...

Ngày tải lên: 09/08/2014, 20:20

3 317 0
báo cáo khoa học: "Prospecting for Genes involved in transcriptional regulation of plant defenses, a bioinformatics approach" pdf

báo cáo khoa học: "Prospecting for Genes involved in transcriptional regulation of plant defenses, a bioinformatics approach" pdf

... Graph of the number of nodes with at least one link for each PCC cutoff (B) Graph of the number of edges between nodes for each PCC cutoff (C) Graph of the network density for each PCC cutoff (D) ... by the Ca2+/calmodulin-binding transcription factor AtSR1, indicating that SA levels are regulated by Ca2+ [56] We found that the gene encoding the Ca2+/calmodulin-binding transcription factor ... Omics-based identification of Arabidopsis Myb transcription factors regulating aliphatic glucosinolate biosynthesis Proceedings of the National Academy of Sciences of the United States of America...

Ngày tải lên: 11/08/2014, 11:20

12 331 0
Báo cáo y học: "Transcriptional regulation of matrix metalloproteinase-1 and collagen 1A2 explains the anti-fibrotic effect exerted by proteasome inhibition in human dermal fibroblasts" docx

Báo cáo y học: "Transcriptional regulation of matrix metalloproteinase-1 and collagen 1A2 explains the anti-fibrotic effect exerted by proteasome inhibition in human dermal fibroblasts" docx

... GAAAGGGCGGGGGAGGGCGGGAG GATGCGGAGGGCGGAG Biotin-COL1A2-AS CTCCGCCCTCCGCATCCTCCCGCCC TCCCCCGCCCTTTC Bold case indicates proximal activation protein-1 (AP-1) site Underlining indicates transcription binding sites (Ets ... AGACTCTTTGTGGCTGGGGAG COL1A2 fw2 GCGGAGGTATGCAGACAACG COL1A2 rv1 GGGCTGGCTTCTTAAATTG MMP-1 ORF fw TAAGTACTGGGCTGTTCAGG MMP-1 ORF rv GAGCAGCATCGATATGCTTC COL1A2 ORF fw GCCCTCAAGGTTTCCAAG COL1A2 ORF rv GGGAGACCCATCATTTCAC ... HsEEF1A1 CACCTGAGCAGTGAAGCCAGCTGCTT DNA pull-down assay Biotin-MMP-1-S GATCGAGAGGATGTTATAAAGCATG AGTCAG Biotin-MMP-1-AS CTGACTCATGCTTTATAACATCCTCT CGATC Biotin-COL1A2-S GAAAGGGCGGGGGAGGGCGGGAG GATGCGGAGGGCGGAG...

Ngày tải lên: 12/08/2014, 12:20

14 286 0
Báo cáo y học: "Transcriptional regulation of lung development: emergence of specificity" pdf

Báo cáo y học: "Transcriptional regulation of lung development: emergence of specificity" pdf

... regulators of epithelial–mesenchymal interactions primary research In vertebrates the trachea includes a number of phenotypically distinct cell types, including ciliated and nonciliated columnar ... neither the signaling nor the transcriptional factors are uniquely lung-specific, indicating that lung specificity must arise from the unique combinatorial interactions of non-specific components Among ... cytodifferentiation can be communicated as positional information through cell–cell interactions that trigger specific patterns of gene expression by the activation of transcriptional regulators reports Concurrently...

Ngày tải lên: 12/08/2014, 18:20

7 182 0
Báo cáo y học: "Quantitative protein expression profiling reveals extensive post-transcriptional regulation and post-translational modifications in schizont-stage malaria parasites" doc

Báo cáo y học: "Quantitative protein expression profiling reveals extensive post-transcriptional regulation and post-translational modifications in schizont-stage malaria parasites" doc

... Gel-loading regimen Gel TP1 TP2 TP3 TP4 Pool gel1 Cy3 Cy5 gel2 Cy5 gel3 Cy3 Cy5 gel4 Cy5 Cy3 Cy2 Cy5 Cy2 Cy2 Cy3 Cy2 Cy2 gel5 Cy3 gel6 Cy3 Cy5 Cy2 gel7 Cy5 Cy3 Cy2 Cy5 Cy2 gel8 Figure Cy3 Each two-dimensional ... occurrence of post- transcriptional regulation in Plasmodium parasites Such post- transcriptional regulation may also explain several discrepancies between mRNA abundance profiles and the expected ... according to the direction of abundance change (see Figure 3b) and subsequently subjected to hierarchical clustering, with the icons in the upper right corner of each panel providing a generic...

Ngày tải lên: 14/08/2014, 21:20

18 257 0
TRANSCRIPTIONAL REGULATION OF ATF4 IS CRITICAL FOR CONTROLLING THE INTEGRATED STRESS RESPONSE DURING eIF2 PHOSPHORYLATION

TRANSCRIPTIONAL REGULATION OF ATF4 IS CRITICAL FOR CONTROLLING THE INTEGRATED STRESS RESPONSE DURING eIF2 PHOSPHORYLATION

... factors, including ATF3, ATF5 and CHOP (2, 76) ATF4 activates these genes by binding to cis-acting elements containing the CCAAT- enhancer binding protein activating transcription factor (C/ EBP-ATF) ... Transcription Factor-3 ATF4 Activating Transcription Factor-4 ATF5 Activating Transcription Factor -5 bZIP Basic Leucine Zipper BCL B-Cell Lymphoma BIM Bcl-2 Interacting Mediator of cell death CARE ... Phosphorylation of the serine residue in the βTrCP recognition motif DSGXXXS results in the interaction of ATF4 with βTrCP (β transducing repeat containing protein), an F-box containing protein which is...

Ngày tải lên: 24/08/2014, 11:02

127 262 0
w