post transcriptional modification of rnas by artificial box h aca and box c d rnps
Tài liệu Báo cáo khoa học: The splicing factor ASF/SF2 is associated with TIA-1-related/ TIA-1-containing ribonucleoproteic complexes and contributes to post-transcriptional repression of gene expression doc
Ngày tải lên :
16/02/2014, 15:20
... EDTA, 2% SDS) and twice extracted with phenol ⁄ chloroform, once extracted with chloroform, and precipitated with ethanol and sodium acetate [62] The quality of the RNA samples was verified by ... UBF1, the ribonucleoprotein hnRNP M, the RNA helicases RHII ⁄ Gu ⁄ DDX21 and p68 ⁄ DDX5, and the SR protein ASF ⁄ SF2 (Fig 1C) The interactions of TIAR with hnRNP M, DDX21 and DDX5 helicases and ASF ... between the nucleus and the cytoplasm Genes Dev 12, 55–66 ` 31 Gui JF, Tronchere H, Chandler SD & Fu XD (1994) Purification and characterization of a kinase speci c for the serine- and arginine-rich...
- 19
- 666
- 0
Báo cáo khoa học: Akt-dependent phosphorylation negatively regulates the transcriptional activity of dHAND by inhibiting the DNA binding activity pdf
Ngày tải lên :
07/03/2014, 16:20
... conclusion, dHAND was phosphorylated by Akt and the phosphorylation inhibited the transcriptional activity of dHAND Although the phosphorylated form of dHAND could dimerize with E-protein, this ... activity of dHANDAsp-X/E47 was much lesser than those of wild type These results indicated that phosphorylation of dHAND decreased the transcriptional activity of dHAND/E47 heterodimer Fig The ... the mock transfected cell lysates did not phosphorylate GSTdHAND, indicating that Akt specifically phosphorylates dHAND To locate the dHAND phosphorylation sites by Akt, we constructed MBP-dHAND...
- 10
- 483
- 0
Báo cáo y học: "Serum-dependent transcriptional networks identify distinct functional roles for H-Ras and N-Ras during initial stages of the cell cycle" doc
Ngày tải lên :
09/08/2014, 20:20
... of functional specificity for H- Ras and N-Ras by documenting the occurrence of specific transcriptional profiles associated with the absence of H- Ras and/ or N-Ras during defined moments of the ... appearance of cellular blebbing and cell detachment Accordingly, we used phase-contrast microscopy in order to detect and quantify the presence of apoptotic cells in cultures of starved and serum-stimulated ... Walsh AB, Bar-Sagi D: Differential activation of the Rac pathway by Ha-Ras and K-Ras J Biol Chem 2001, 276:15609-15615 Ehrhardt A, David MD, Ehrhardt GR, Schrader JW: Distinct mechanisms determine...
- 24
- 359
- 0
Báo cáo y học: "Proteome changes of lungs artificially infected with H-PRRSV and N-PRRSV by two-dimensional fluorescence difference gel electrophoresis" pps
Ngày tải lên :
12/08/2014, 04:20
... oligonucleotide primers NSP2F(5'AACACCCAGGCGACTTCA-3') and NSP2R(5'-GCATGTCAACCCTATCCCAC-3') which designed according to the existing 87 base deletion between the H- PRRSV and N- PRRSV in the fixed ... cellular concentrations of methylarginines, which in turn inhibit nitric oxide synthase activity The recent study has indicated that the activity of DDAH and the expression of DDAH2 (mRNA and protein) ... significantly decreased in cobalt chloride (CoCl2)-induced apoptosis In contrast, DDAH2 overexpression inhibited the proapoptotic effects of CoCl2 [47] CoCl2 significantly increased the level of endogenous...
- 17
- 242
- 0
Báo cáo y học: " Modification of a loop sequence between -helices 6 and 7 of virus capsid (CA) protein in a human " pot
Ngày tải lên :
12/08/2014, 23:21
... established T cell line HSC-F and in CD8+ cell depleted peripheral blood mononuclear cells (PBMCs) from CMs Materials and methods DNA constructions The HIV-1 derivatives were constructed on a background ... Structure of the chimeric HIV-1/SIVmac clones and a summary of their replication capabilities Structure of the chimeric HIV-1/SIVmac clones and a summary of their replication capabilities White ... PBMCs were obtained from CM, after which the CD8+ cells were removed, and the cells were stimulated with PHA-L for day (B) CD8-depleted CM PBMC were first stimulated with g/ml of PHA-L for days...
- 11
- 235
- 0
Báo cáo y học: "Human T-cell leukemia virus type 2 post-transcriptional control protein p28 is required for viral infectivity and persistence in vivo" ppt
Ngày tải lên :
13/08/2014, 05:20
... have been associated with HTLV-2 infection [8-12] HTLV-1 and HTLV-2 have the capacity to promote T-lymphocyte growth both in cell culture and in infected individuals; however, the mechanism by ... generated from the HTLV-2 molecular clone pH6neo To construct HTLV-2Δp28, a single nucleotide was altered by site directed mutagenesis, which introduced a stop codon at amino acid of the p28 ORF and ... vivo studies, and drafted the manuscript ML developed the realtime PCR primers and performed or assisted with all the assays and quantitation MK helped with the collection and processing of in...
- 11
- 277
- 0
Báo cáo y học: " Treatment of candidemia and invasive candidiasis in the intensive care unit: post hoc analysis of a randomized, controlled trial comparing micafungin and liposomal amphotericin " pot
Ngày tải lên :
13/08/2014, 19:20
... of poor outcomes among patients with candidemia [3-8] Candida epidemiology has changed as infections due to nonalbicans Candida species have increased [9] This shift in the prevalence of Candida ... Disseminated candidiasis Organism Candida albicans only versus non-albicans Candida C albicans, Candida tropicalis, Candida parapsilosis, Candida glabrata versus other Candida spp Candida parapsilosis ... amphotericin B for the treatment of invasive candidiasis and candidemia, and showed better tolerability compared with liposomal amphotericin B [28,29] We conducted a post hoc analysis of the phase...
- 10
- 378
- 0
Báo cáo khoa học: Characterization of oligosaccharides from the chondroitin/dermatan sulfates 1 H-NMR and 13 C-NMR studies of reduced trisaccharides and hexasaccharides doc
Ngày tải lên :
16/03/2014, 14:20
... lyophilization, and then stored at )20 C The individual oligosaccharides were purified, from the CS trisaccharide, tetrasaccharide and hexasaccharide pools recovered after HW40 SEC, by strong anion-exchange ... GalNAc (E) Hexasaccharides Although data from disaccharides, trisaccharides and tetrasaccharides are valuable for the detailed structural characterizations of unknown segments derived from the CS ... preparation and structural characterization of unreduced DS oligosaccharides of up to dodecasaccharide in size has been discussed [23]; a combination of 1D and 2D NMR together with electrospray...
- 11
- 481
- 0
The Project Gutenberg eBook, Analyzing Character, by Katherine M. H. Blackford and Arthur pptx
Ngày tải lên :
28/06/2014, 17:20
... of the things made by people who were captained by men of ability who were discovered by Pericles." The remark of Andrew Carnegie that he won his success because he had the knack of picking the ... of practice, to guess the power of his bow, the weight and balance of his arrow, and the range and direction of his target; also, the sweep of the wind This he gained by observations repeated ... foot race instead of a hand-over-hand ropeclimbing contest Worse than his ineptitude, however, is the waste and atrophy of his best powers through disuse Thus the early settlers of the Coachela...
- 1.8K
- 354
- 0
Principles of microeconomics 4th ed robert h frank and bernanke
Ngày tải lên :
18/11/2016, 10:05
... Principles of Microeconomics First Edition Samuelson and Nordhaus Economics, Microeconomics, and Macroeconomics Eighteenth Edition Schiller The Economy Today, The Micro Economy Today, and The Macro ... Fellow of the Econometric Society and of the American Academy of Arts and Sciences He served as the Director of the Monetary Economics Program of the National Bureau of Economic Research (NBER) and ... WORLD OF SCARCITY economics the study of how people make choices under conditions of scarcity and of the results of those choices for society Scarcity Even in rich societies like the United States,...
- 482
- 5.3K
- 0
Báo cáo khoa học: Induction of translationally controlled tumor protein (TCTP) by transcriptional and post-transcriptional mechanisms pot
Ngày tải lên :
16/03/2014, 05:20
... transcription by actinomycin D treatment did not accelerate mRNA decay as expected; instead, it slowed down this process slightly Nickel and cobalt treatment delayed TCTP mRNA decay further, and clearly ... in the presence of [32P]UTP and incubated with cytoplasmic cell extracts (S10) of Calu-6 cells (control) or cells, in which TCTP was induced for 24 h by PMA, dioxin, NiCl2, or CoCl2 After UV-crosslinking ... anti-(glyceraldehyde-3-phosphate dehydrogenase) (Acris Antibodies GmbH, Hiddenhausen, Germany) antibodies, with a secondary antibody (anti-mouse; Santa Cruz) to detect relative b-actin and glyceraldehyde-3-phosphate...
- 9
- 374
- 0
Báo cáo khoa học: Transcriptional regulation of the desferrioxamine gene cluster of Streptomyces coelicolor is mediated by binding of DmdR1 to an iron box in the promoter of the desA gene doc
Ngày tải lên :
16/03/2014, 11:20
... desA-3 desD-5 desD-3 Pf GCGGCGACGGCGACGGCAAGAG CGGGGGAGCGGGCGATGACCT GCAGATGCGCGTGCCAGACC CGGCGCCAGTAGCCGACGAAG CGGGTGGCCGCCAAACTCG AGGAAGCGCGGTCAAGGGAGTCTC CGCAAGGCGCTGGCCGAGTTCA TGTGCAGCAGCGGGACGTAGTAGG ... containing the apramycin resistance gene [aac(3)IV] and oriT was used as template The mutant was constructed using the oligonucleotides 5¢-acccc tctcggaccgtccccaccggaggacccccccatgATTCCGGGGATC ... TGTGCAGCAGCGGGACGTAGTAGG GGAATTCCGCGCGCGGGTCTGGCTTCA RT-PCR RT-PCR RT-PCR RT-PCR RT-PCR RT-PCR RT-PCR RT-PCR PCR cloning of the desA promoter Pr O6 hrdB-5 hrdB-3 CGGGATCCCGGTACTGCTCCGCGGTGGTGTCGTT GCGATCGCTGCCACTGC...
- 13
- 456
- 0
Báo cáo khoa học: Loss of sense transgene-induced post-transcriptional gene silencing by sequential introduction of the same transgene sequences in tobacco pot
Ngày tải lên :
22/03/2014, 21:20
... interfering RNAs (called siRNAs) by DICER-like protein4 The single-stranded siRNA is incorporated into a multicomponent RNAinduced silencing complex and guides the endonucleolytic cleavage of transcripts ... determined, followed by the detection of NtFAD3 mRNAs and siRNAs (B) Characterization of the sequentially transformed plants with pTF1SIIn and pEx9-GUS -h The levels of 18:3 in total fatty acids and the ... NtFAD3 sense and NtFAD3:GUS chimeric sense transgenes (A) Schematic drawing of the El2 promoter region The AccI, HinfI and MboI sites are indicated The lengths of the predicted restriction fragments...
- 9
- 387
- 0
báo cáo khoa học: " Investigation of post-transcriptional gene regulatory networks associated with autism spectrum disorders by microRNA expression profiling of lymphoblastoid cell lines" pps
Ngày tải lên :
11/08/2014, 12:20
... autistic individuals and controls based on the 43 significant probes, which was also validated by support vector machine analysis that demonstrated 100% accuracy of class prediction (data not shown) ... brain-speci c hsa-miR-219, which is associated with circadian rhythm and N-methyl -D- aspartate (NMDA) glutamate receptor signaling, both of which have been implicated in ASD [72-77,80,81] In particular, ... (Period homolog 1), PER3 (Period homolog 3), and DPYD (Dihydropyrimidine dehydrogenase), were differentially expressed exclusively in the most severe phenotype of ASD, which was characterized by...
- 18
- 287
- 0
Báo cáo y học: " Post-transcriptional control by bacteriophage T4: mRNA decay and inhibition of translation initiation" pdf
Ngày tải lên :
11/08/2014, 21:21
... I I I I L S S S S S S S S S S S S S S S S S S S S S S S S S CH CH CH CH CH CH CH CH CH CH CH CH CH CH CH CH CH CH CH CH CH CH CH CH CH 40 I I I I I I I I I I I I I I I I I I I I I I I I I I LQ ... polynucleotide termini and the hydrolysis of 3’-phosphomonoesters and 2’:3’-cyclic phosphodiesters Indeed, Durand et al (2008; unpublished data) showed that the secondary cleavages are abolished ... E E D MT E E D MT E E D MT E E D MT E E D MT E E D MT E E D I DGED I DGED I DGED MT WE D MT WE D MT E DD MS E DD I DD E D I T E ED I SQ E D I SE ED I SD E D I SD E D MSQ E D I T AED I TDED L...
- 22
- 383
- 0
Tài liệu Effect modification of air pollution on Urinary 8-Hydroxy-2’-Deoxyguanosine by genotypes: an application of the multiple testing procedure to identify significant SNP interactions ppt
Ngày tải lên :
17/02/2014, 22:20
... also adjusted for chronic disease status (cardiovascular disease or chronic respiratory diseases) as a dummy variable [23] We examined effect modification by each of candidate SNP via adding an ... tissues by the vitamin D- binding protein, which is encoded by GC [61] Studies show that polymorphisms of vitamin D- related genes are associated with various cancers, cardiovascular diseases and respiratory ... 178:13-19 Góth L, Vitai M: The effects of hydrogen peroxide promoted by homocysteine and inherited catalase deficiency on human hypocatalasemic patients Free Radic Biol Med 2003, 35:882-888 Chen YH, Lin...
- 9
- 772
- 0
Báo cáo khoa học: E2A participates in a fine control of pre-mature B-cell apoptosis mediated by B-cell receptor signaling via transcriptional regulation of survivin, IAP2 and caspase-8 genes pot
Ngày tải lên :
16/03/2014, 04:20
... showed similar effects on the expression of CAD and ICAD genes in both DT40 and E2A)/), i.e the CAD mRNA level decreased by h but thereafter increased to the control level by 24 h, and the ICAD ... apoptotic cell death of the DT40 cell line, through depletion of ICAD [inhibitor of caspase-activated DNase (CAD)] and inhibitor of apoptosis (IAP2), and activation of caspase activities [24] Based ... decreased by h and thereafter remained unchanged at 24 h in the presence of PMA/ionomycin These findings indicate that E2A and BCR stimulation have no effects on gene expression of CAD and ICAD, in contrast...
- 11
- 349
- 0
Báo cáo khoa học: Functional interplay between viral and cellular SR proteins in control of post-transcriptional gene regulation pptx
Ngày tải lên :
23/03/2014, 06:20
... and hence pre-mRNA splicing inhibition [30] Moreover, adenovirus infection induces de novo synthesis of ceramide followed by nonapoptotic cell death, and adenovirus E4-ORF4 can act through this ... function The hepatitis C virus (HCV) core protein interacts with RNA helicase DDX3 SR splicing factors modulate viral RNA splicing HCV is a major cause of chronic liver diseases, and its core ... are underlined Phosphorylation of the highlighted serine and threonine residues has been reported (see the text) Different highlights in the DHBV core protein represent different phosphorylation...
- 10
- 317
- 0
báo cáo hóa học:" Transcriptional regulation of bone formation by the osteoblast-specific transcription factor Osx Chi Zhang" pptx
Ngày tải lên :
20/06/2014, 04:20
... region and adult lumbar spine BMD In light of these findings, this research group genotyped a further 3692 individuals from ALSPAC who had whole body BMD and confirmed the association in children ... expression of type I collagen (Col1a1) in the condensed mesenchyme of the membranous skeleton and the periosteum and mesenchyme of the endochondral skeleton is severely reduced Expressions of the osteoblast-specific ... fertile Homozygous Osx mutant mice were lethal and these mice had difficulty in breathing, rapidly became cyanotic, and died within 15 of birth Newborn homozygous mutant mice showed severe inward bending...
- 8
- 491
- 0