polymer induced phase separation and crystallization in model immunoglobulin g solutions
Properties of the hole injection layer in organic semiconducting devices
Ngày tải lên :
14/09/2015, 14:06
... conducting surface to avoid sample charging which would result in shifting of the binding energy values The samples are irradiated by UV in an ultra high vacuum chamber and the resulting photoelectrons ... wavelength of the incident light (Rayleigh scattering) The exciting photons may interact with the molecules and scatter the photons with energy differing in quantized increments according to the phonon ... efficiencies than those without; including PEDT:PSSH planarizing the 26 ITO surface,36 energy alignment/Fermi-level pinning39 and electron blocking effect by the insulating PSS at the surface of PEDT:PSSH.40...
- 135
- 1.1K
- 0
Báo cáo khoa học: Light-induced reactions of Escherichia coli DNA photolyase monitored by Fourier transform infrared spectroscopy pot
Ngày tải lên :
16/03/2014, 18:20
... (forward) GAGCGGATAACAATTTCACACAG Rct (reverse) ACAGGAGTCCAAGCTCAGCTAATT Ply5 (mismatch) CCCGGGCCCGCGCATTCACTTCATACTG The general scheme of mutagenic PCR involved two rounds of amplification cycles using ... agar containing 150 mgÆL)1 ampicillin The plasmid was reisolated and electroporated into the expression strain M15[pREP4], which was then plated on LB agar containing 150 mgÆL)1 ampicillin and ... describing the UV-light driven formation of thymidine dimers (trace A in Fig 5) For ease of viewing, trace A of Fig is depicted again in Fig as trace A, and the time trace after 20 of white-light...
- 12
- 393
- 0
báo cáo hóa học:" Fourier-transform infrared anisotropy in cross and parallel sections of tendon and articular cartilage" pptx
Ngày tải lên :
20/06/2014, 01:20
... tendon and cartilage from all different surfaces of the 3D tissue cube were investigated using infrared imaging To the best of our knowledge, there has been no study in literature regarding the infrared ... spectrum and structure of collagen and related peptides Biopol 1985, 24:1449-1478 Potter K, Kidder LH, Levin IW, Lewis EN, Spencer RG: Imaging of collagen and proteoglycan in cartilage sections using ... illustration is given in Figure 7, which incorporates the tilting angles of the transitional moments of amide bonds in collagen fibrils as well as the effect of polarization in infrared imaging It is...
- 12
- 384
- 0
báo cáo hóa học:" Analysis of ovarian tumor pathology by Fourier Transform Infrared Spectroscopy" pdf
Ngày tải lên :
20/06/2014, 07:20
... Magnetic Resonance Imaging (MRI) and Ultrasound Imaging Studies have shown that ultrasound gives a poor accuracy in detecting early stage disease [6] A much more accurate ultrasound imaging screening ... screening test is the Trans Vaginal Ultrasonography (TVS) which gives impressive results, however it is inefficient in distinguishing between benign and malignant masses The only way to diagnose ... changes in the molecular geometry and hydrogen bondings of peptide groups [39] In comparison to normal tissue, malignant tissue spectrum exhibits shifting along with intensity variation in the bands...
- 6
- 324
- 0
Fourier transformed infrared absorption spectroscopy and kinetics studies of gas phase small molecules
Ngày tải lên :
15/09/2015, 17:11
... teaching me how to use good English during the course of my PhD I am grateful to my group members; Li Peng, Tan Yen Ling, Jason Yang Jiexiang, Tan Hua, Zhan Tong, Christian Lefföld, Lim Kok Peng, ... frequencies and band strengths of the species involved and the energies and geometries of reactive intermediates and transition states in these reactions will be determined However, the assumed dominant ... between CS2 and O atom This was accomplished by deliberately adding CS2 into the cell containing NO2 and CSe2 and allowing both CSe2 and CS2 to react competitively with O atoms Since the rate...
- 152
- 276
- 0
Real-Time Digital Signal Processing - Chapter 7: Fast Fourier Transform and Its Applications
Ngày tải lên :
28/10/2013, 05:15
... The floating-point program will be used as reference for the code development using the fixed-point C and assembly language The floating-point program uses the floating-point data file input7_f.dat, ... decimation -in- time FFT algorithm using the floatingpoint C, fixed-point C, and assembly language We then implement the IFFT algorithm using the same FFT routine Finally, we apply both the FFT and IFFT ... saving in computation when N is large after only one stage of splitting signals into even and odd sequences If we continue with this process, we can break up the single N-point DFT into log2...
- 47
- 634
- 0
Tài liệu Báo cáo Y học: Electrochemical, FT-IR and UV/VIS spectroscopic properties of the caa3 oxidase from T. thermophilus docx
Ngày tải lên :
21/02/2014, 15:20
... V (vs Ag/AgCl/3M KCl) equilibrated in H2O (A) and D2O buffer (B) around 1650 cm)1 (water OH-bending mode and amide-I C¼O mode), was the noise level slightly higher, though never exceeding 10)4 ... propionates and the vinyl substituent can be expected, originating from heme c, with contributions from the formyl groups and from the geranyl side chain expected from heme a and a3 In addition ... However, we refrain from discussing and assigning these modes on the basis of the data presented here, in spite of the fact that bands in the difference spectra are observed in the region where the...
- 9
- 528
- 0
Báo cáo khoa học: Determination of thioxylo-oligosaccharide binding to family 11 xylanases using electrospray ionization Fourier transform ion cyclotron resonance mass spectrometry and X-ray crystallography pot
Ngày tải lên :
07/03/2014, 17:20
... Crystallography, 2nd edn Springer-Verlag, New York, USA Heightman TD & Vasella AT (1999) Recent insights into inhibition, structure, and mechanism of conguration-retaining glycosidases Angew Chem Int ... presented in Fig 6, even at the highest ligand concentrations the proteins were still far from saturation, indicating relatively low binding constants The nonspecic binding was also observed in the ... Here, we distinguished between these two types of binding from the crystal structures, given that only a single binding site exists in each xylanase, capable of occupying only one inhibitor molecule...
- 17
- 382
- 0
Báo cáo khoa học: Structural study of the catalytic domain of PKCf using infrared spectroscopy and two-dimensional infrared correlation spectroscopy pot
Ngày tải lên :
16/03/2014, 13:20
... modulate the secondary structure significantly To gain further insight into the structure and folding of cat-f and into the structural changes that occur during MgATP binding, thermal-stability studies ... or changes induced in the protein by external agents [20] Spectra were obtained using H2O and D2O buffers, and the spectra shown were obtained by subtracting the spectra of buffers and ligands ... The kinase domain of PKCf, as well as other members of the AGC group, includes an MgATP-binding region, an activation loop, a turn motif and a hydrophobic motif The MgATP-binding region contains...
- 14
- 383
- 0
Comparison between the Matrix Pencil Method and the Fourier Transform Technique for High-Resolution Spectral Estimation
Ngày tải lên :
26/03/2014, 00:29
... The window in the time domain is applied by weighting the input samples, zi , with the window coefficients, hi , by modifying Eq (5.1.2) in the following way: (5.2.4) 0, otherwise; Standard window ... working toward his Ph.D degree in the University of Cantabria, studying different topics related to applied electromagnetics His research interests include signal processing and electromagnetic ... Enterprises in 1985, which has been engaged in signal processing research and development, with several governmental and industrial organizations He is also a professor in the Department of Electrical and...
- 18
- 415
- 0
Báo cáo hóa học: " Aqueous-Phase Synthesis of Silver Nanodiscs and Nanorods in Methyl Cellulose Matrix: Photophysical Study and Simulation of UV–Vis Extinction Spectra Using DDA Method" docx
Ngày tải lên :
21/06/2014, 17:20
... concentric ring with intermittent bright dots, indicating that the samples are highly crystalline in nature A closer look on the SAED pattern of Fig 1b(ii) suggests that the ring having d-values ... spherical in shape with diameter ranging between and nm Particle size distribution histograms of silver seeds are given in Fig 2a HR-TEM micrograph (Fig 1b) of the red coloured silver sol, obtained ... the growth of citrate-stabilized gold nanoparticles by the seed-mediated method using a wide range of reducing agents and conditions [11, 25] Using the same approach, they were able to prepare gold...
- 8
- 348
- 0
báo cáo hóa học:" Research Article Pitch- and Formant-Based Order Adaptation of the Fractional Fourier Transform and Its Application to Speech Recognition" pptx
Ngày tải lên :
21/06/2014, 20:20
... C Huang, and E Chang, “Tone articulation modeling for Mandarin spontaneous speech recognition,” in Proceedings of IEEE International Conference on Acoustics, Speech, and Signal Processing (ICASSP ... speech signal using MWL criterion,” in Proceedings of Canadian Conference on Electrical and Computer Engineering, vol 3, pp 1769–1772, 2004 [10] F Gianfelici, G Biagetti, P Crippa, and C Turchetti, ... Tecnolog´a del Habla, JTH 2008, Bilbao, Spain, and also at ı the 6th International Symposium on Chinese Spoken Language Processing, ISCSLP ’08, Kunming, China References [1] H M Teager and S M Teager,...
- 14
- 384
- 0
Electron transfer of carotenoids imbedded in MCM 41 and ti MCM 41 EPR, ENDOR and UV vis studies
Ngày tải lên :
29/07/2015, 02:43
... line The signal with g1 ) 2.0115, g2 ) 2.0029 and g3 ) 2.000 is characteristic of the O2•- species generated in MCM-41 (g1 ) 2.012, g2 ) 2.003 and g3 ) 2.00).16,44 The absence of the Car•+ signal ... line with g1 ) 2.021, g2 ) 2.008 and g3 ) 2.001 characteristic of a Ti4+(O2•-) species.46,47 Another signal at high field is also observed with g ) 1.959 and g| ) 1.903 similar in g values (g ... is in the measurement error range), indicating that II does not interact with Ti4+ The blue shift of λmax of Car can be explained by a change in the π-conjugation along the Car conjugated chain...
- 8
- 366
- 0
Fast fourier transform on multipoles algorithm for elasticity and stokes flow
Ngày tải lên :
11/09/2015, 16:06
... volume integration by the FMM, and Greengard and Lee [23] calculated particular solutions with spectral method in a decomposed domain and patches the solutions together with the FMM Ying 14 CHAPTER ... successfully in many areas in science and engineering including heat transfer [32], fluid mechanics [68, 67], acoustics [14, 84], electromagnetics [63] and solid mechanics [1] The critical concept in the ... using local intrinsic coordinates When x and y are on different elements, the standard Gaussian quadrature (with Gauss points over each element) is applied to perform the integration When x and...
- 165
- 380
- 0
Accurate and efficient three dimensional electrostatics analysis using singular boundary elements and fast fourier transform on multipole (FFTM)
Ngày tải lên :
15/09/2015, 21:09
... Non-singular integral 26 4.2.2 Singular integral due to fundamental solution only 27 4.2.3 Singular integral due to singular shape function only 27 4.2.4 Singular integral ... weakly singular corner 48 Figure 5.8 Locations of Edge singular elements, and (b) Edge singular element definitions 51 Figure 5.9 definitions (a) Locations of Corner singular elements, and ... (4.15) Singular integral due to singular shape function only This singular integral occurs only in (4.10a), when N q (ξ ) is the singular shape function N1s derived in (4.8) Strictly speaking, only...
- 168
- 159
- 0
So sánh hai phương pháp định lượng Berberin nguyên liệu bằng HPLC theo dược điển Trung Quốc (2005) và bằng đo quang phổ hấp thụ UV-VIS theo dược điển Việt Nam III.DOC
Ngày tải lên :
07/09/2012, 14:57
... mức ý nghĩa 0,05 giá trị trung bình hàm lợng Berberin nguyên liệu hai phơng pháp định lợng khác ý nghĩa thống kê 2.2.3.2 Đánh giá u nhợc điểm hai phơng pháp định lợng Berberin clorid bột nguyên ... Nồng độ dung dịch g n nhau, kết xác Ngoài có kỹ thuật định lợng khác nh: phơng pháp đờng chuẩn, phơng pháp thêm đờng chuẩn, phơng pháp chuẩn độ đo quang, phơng pháp định lợng hỗn hợp theo nguyên ... : giá trị trung bình kết định lợng hai phơng pháp khác ý nghĩa thống kê n t T> + /2 n : giá trị trung bình kết định lợng hai phơng pháp khác có ý nghĩa thống kê n t + /2 n tra bảng mức tin...
- 34
- 4.1K
- 14
The Discrete Fourier Transform
Ngày tải lên :
13/09/2012, 09:49
... extending from negative infinity to positive infinity You cannot use a group of infinitely long signals to synthesize something finite in length The way around this dilemma is to make the finite ... sample in the frequency domain is found by multiplying the time domain signal by the sine or cosine wave being looked for, and adding the resulting points If someone asks you what you are doing, ... point signal being decomposed into 18 sinusoids, each consisting of 16 points In more formal terms, the 16 point signal, shown in (a), must be viewed as a single period of an infinitely long periodic...
- 28
- 677
- 0
Fourier Transform Properties
Ngày tải lên :
13/09/2012, 09:49
... Scientist and Engineer's Guide to Digital Signal Processing Figures (d) and (h) shows something of a riddle First imagine that (d) was formed by shifting the waveform in (c) slightly more to the right ... signal in (b) is created by taking the DFT of (a), replacing the phase with random numbers, and taking the Inverse DFT The signal in (c) is found by taking the DFT of (a), replacing the magnitude ... FIGURE 10-12 Compression and expansion Compressing a signal in one domain results in the signal being expanded in the other domain, and vice versa Figures (c) and (d) show a discrete signal and...
- 24
- 477
- 0
Fourier Transform Pairs
Ngày tải lên :
13/09/2012, 09:49
... to Digital Signal Processing Gibbs Effect Figure 11-6 shows a time domain signal being synthesized from sinusoids The signal being reconstructed is shown in the last graph, (h) Since this signal ... signal using frequencies through 100 This signal was created by taking the DFT of the signal in (h), setting frequencies 101 through 512 to a value of zero, and then using the Inverse DFT to find ... and Engineer's Guide to Digital Signal Processing equations only provide the magnitude The phase is determined solely by the left-right positioning of the time domain waveform, as discussed in...
- 16
- 495
- 1
The Fast Fourier Transform
Ngày tải lên :
13/09/2012, 09:50
... looping through the samples inside any one box in Fig 12-2) The overhead boxes in Fig 12-7 determine the beginning and ending indexes for the loops, as well as calculating the sinusoids needed in ... calculation element in the FFT, taking two complex points and converting them into two other complex points xS point output 232 The Scientist and Engineer's Guide to Digital Signal Processing This simple ... domain procedure of combining two point signals by interlacing Consider two time domain signals, abcd and efgh An point time domain signal can be formed by two steps: dilute each point signal...
- 18
- 555
- 1