... broad-range PCR, cloning and sequencing the entire 16S rDNA and demonstrated the presence of a large number of bacterial DNA in the synovial tissue (ST) of patients with ReA, UA, and other arthropathies ... until analysis Automated DNA extraction from synovial fluid and broad-range PCR amplification of 16S rRNA genes, cloning and sequencing of bacterial DNA For 10 minutes, 500 μl of SF were centrifuged ... study using PCR as well as cloning and sequencing of the entire 16S rDNA to identify any bacterial DNA potentially present in the SF samples of patients with ReA, UA, and other forms of arthritis...
Ngày tải lên: 09/08/2014, 14:22
... DNA in patients with ReA and UA using broad-range PCR, cloning and sequencing of almost the entire 16S rRNA gene The use of this approach revealed the identity of potential bacterial causes and ... post -PCR rooms, and dedicated sets of pipettes, disposable gloves, laboratory coats and non-reusable waste containers Reagents and PCR primers were aliquoted to prevent frequent handlings DNA ... http://arthritis-research.com/content/10/2/R40 Table Summary of PCR results and cloning details Patient PCR intensity scorea Total number of clones sequenced Number of obtained bacterial DNA sequences ReA ++++ 47 38 +++...
Ngày tải lên: 09/08/2014, 10:23
Carbon nanotubes and branched DNA based nucleic acid assays towards a PCR free detection and quantification of nucleic acids
... double-strand DNA (dsDNA) .131 4.2.6.2 Purification of biotinylated dsDNA and gel electrophoresis .132 4.2.6.3 Purification of sense p185-ssDNA 133 4.2.7 Real-time quantitative PCR (RQ -PCR) ... bench-marked by the RQ -PCR Successful detection of the p185-ssDNA by both CNT-based label and bDNA hybridization assays indicated good integrity and functionality of the standard The approach offers a means ... 91 Table 4.1 Sequences of primers used in general PCR, RT -PCR and RQ -PCR 128 Table 4.2 Typical yields of mRNA extracted from individual batches of (A) SUP-B15 and (B) HL-60 cell cultures...
Ngày tải lên: 12/09/2015, 09:28
Tài liệu Soft Computing for Optimal Planning and Sequencing of Parallel Machining Operations docx
... presented our study of the optimal planning and sequencing for parallel machining operations The combinatorial nature of sequencing and the complication of having precedence and mode constraints ... performance of the proposed GA, the number of mutations was increased from one to two in each of the above settings (see Figures 8.10 and 8.11) From Figures 8.10 and 8.11, it is noticed that mutations of ... Nee and A.N Poo, Integrated application of expert systems and neural networks for machining operation sequencing, in Neural Networks in Manufacturing and Robotics, Y.C Shin, A.H Abodelmonem and...
Ngày tải lên: 25/12/2013, 19:15
Tài liệu Báo cáo khoa học: Molecular cloning and characterization of soybean protein disulfide isomerase family proteins with nonclassic active center motifs pdf
... were immediately frozen and stored in liquid nitrogen until use Cloning of GmPDIL-3a and GmPDIL-3b Cloning of the cDNAs for GmPDIL-3a and GmPDIL-3b was performed by 3¢-RACE and 5¢-RACE Soybean trifoliolate ... Identification of the initiation codons in GmPDIL-3a and Gm-PDIL-3b mRNAs (A) Schematic representation of the structure of GmPDIL-3a and GmPDIL-3b mRNAs The putative ORFs (gray boxes) of GmPDIL-3a and GmPDIL-3b ... stage of embryogenesis Therefore, we next measured the mRNA and protein levels of GmPDIL-3a and GmPDIL-3b by real-time RT -PCR and western blotting, respectively, during different stages of development...
Ngày tải lên: 18/02/2014, 11:20
Tài liệu Báo cáo khoa học: Cloning and characterization of CBL-CIPK signalling components from a legume (Pisum sativum) ppt
... Isolation and sequence analysis of PsCIPK and CBL cDNAs and genomic clones For cDNA cloning, first partial fragments of 550 bp for PsCIPK and 335 bp for PsCBL were amplified by PCR using double-stranded ... stresses used for treatment of pea seedlings were cold (A and B), salinity (C and D), wounding (E and F), drought (G and H), SA (I and J), ABA (K and L) and calcium (N and O) Panel M is the control ... Figure 7A, D, I and L are diamidino-2phenylindole hydrochloride (DAPI) stained cells showing the nucleus, and Fig 7C, F, K and N are the merged images of A and B, D and E, I and J, and L and M, respectively...
Ngày tải lên: 19/02/2014, 07:20
Tài liệu Báo cáo khóa học: Cloning and characterization of two distinct isoforms of rainbow trout heat shock factor 1 ppt
... from the Nikko Branch of the National Research Institute of Aquaculture (Tochigi, Japan) and reared on a commercial diet at 15 °C Cloning of HSF cDNA A random primed kZAPII cDNA library was constructed ... ENDGAPS, off; NOPGAPS, off; NOHGAPS, off Graphical output of the bootstrap figure was produced by the program TREEVIEW Isolation of RNA and RT -PCR analysis Total RNA was isolated from RTG-2 cells and ... 2400, Perkin Elmer) The PCR consisted of one initiation cycle of 15 at 95 °C, amplification cycles of 0.5 at 94 °C, 0.5 at 50 °C and 0.5 at 72 °C, and one termination cycle of at 72 °C, with 35 cycles...
Ngày tải lên: 19/02/2014, 12:20
Tài liệu Báo cáo Y học: Purification, characterization, cloning, and expression of the chicken liver ecto-ATP-diphosphohydrolase pot
... preparation of DNA for sequencing and transfection DNA sequencing was provided by the San Diego State University Microchemical Core Facility Transient and stable transfection COS-7 and HeLa cells ... other hand, it was inhibited by high concentrations of azide, an inhibitor of CD39 and most ecto-ATPDases [29–31], and high concentrations of fluoride, vanadate, and pyrophosphate, inhibitors of the ... primers and thermal cycling conditions but with Advantage Taq DNA polymerase (Clontech) for subsequent TA cloning The 1.5-kb PCR product was gel purified and ligated to pCR2 .1 (Invitrogen) and an...
Ngày tải lên: 22/02/2014, 04:20
Báo cáo khoa học: Molecular cloning and characterization of two soybean protein disulfide isomerases as molecular chaperones for seed storage proteins doc
... during the course of the folding process of these proteins Results Cloning and expression of GmPDIL-1 and GmPDIL-2 To clone the soybean ortholog of Arabidopsis PDI-like 1-1 and PDI-like 1-3 categorized ... between a and b and b¢ and a¢ (Fig 1C) In the case of GmPDIL-2, Lys175, Glu43, Glu62, Glu68 and Glu135 were identified by N-terminal sequencing of the enzymatic digest fragments, respectively, and Glu541 ... region between b and b¢ in GmPDIL-1, and between b and b¢ and b¢ and a¢ in GmPDIL-2, the structure of these regions may be protease resistant The activity of recombinant GmPDIL-1 and GmPDIL-2, which...
Ngày tải lên: 07/03/2014, 05:20
Báo cáo khoa học: Molecular cloning and characterization of methylenedioxy bridge-forming enzymes involved in stylopine biosynthesis in Eschscholzia californica doc
... (R,S)-tetrahydroberberine Amplification of cytochrome P450 cDNA fragments from single-stranded cDNAs of cultured E californica cells Single-stranded cDNAs were synthesized from 1.4 lg of total RNA of 12-day-old cultured ... parameters of CYP719A3, the amount of nandinine produced was estimated by using the calibration curve of (S)-scoulerine (pmol versus peak area) and the absorption ratio of (S)-scoulerine and (S)-nandinine ... Ikezawa et al Full-length CYP719A2 and CYP719A3 cDNAs were amplified by PCR using the same single-stranded cDNAs as those used for the amplification of P450 cDNA fragments The following primers...
Ngày tải lên: 07/03/2014, 10:20
Báo cáo khoa học: Cloning and characterization of the genes encoding toxic lectins in mistletoe (Viscum album L) pot
... NXT) and disulfide bonds are marked genomic DNA or cDNA as a template The PCR products were cloned and sequenced Partial sequencing of more than 40 cDNA and genomic clones revealed three groups of ... 5¢-GACCGGATCCCTCTGGGTAGAGAG-3¢ and PstI The product of the second round of PCR was cloned and the 1066 bp sequence encoding 125 amino acids of the A-chain, the 19 amino acids linker, and 216 amino acids of the B-chain of ... product of ml1p variants giving 169 and 246 bp fragments SalI cuts the amplification product of ml2p, giving 66, 121 and 243 bp fragments, and the amlpification product of ml3p and ml3.1p, giving 50 and...
Ngày tải lên: 07/03/2014, 15:20
Báo cáo khoa học: Cloning and expression of the first nonmammalian interleukin-11 gene in rainbow trout Oncorhynchus mykiss pdf
... of this clone was highly induced in tissues of bacterial infected fish, a full-length cDNA clone as well as a genomic DNA clone were isolated and sequenced, and the expression and modulation of ... 5¢- and 3¢-UTR The major differences were a 26 bp insertion in the 5¢-UTR of the cDNA and an insertion of 12 repeats with a consensus of CCAATGATGATCCAAGAAATCCACACTACAG (31 bp) in the 3¢-UTR of ... Expression of trout IL-11 in tissues A range of cDNAs was prepared from tissue samples from three healthy rainbow trout and used for amplification of IL-11 (Primer EF and ER, expected size: 271 bp) and...
Ngày tải lên: 07/03/2014, 16:20
Báo cáo Y học: Cloning and expression of sterol D14-reductase from bovine liver potx
... and eluted with 0.1 M glycine buffer (pH 3.0) [28] RT -PCR cloning of the bovine cDNA encoding sterol D14-reductase BLASTN search of the bovine EST database was performed to identify bovine cDNA ... was inactivated at 90 °C for Following ®rststrand synthesis, PCR of D14-SR cDNA was carried out using appropriate primers and the Expand Long Template PCR System The two primers used were the sense ... BE754556 and AW427392) [34] The bovine cDNA was synthesized by RT -PCR using synthetic primers based on the EST sequences, cloned into the pCR2 .1 vector, and sequenced on both strands The cloned cDNA...
Ngày tải lên: 08/03/2014, 16:20
Báo cáo Y học: Molecular cloning and characterization of isomultiflorenol synthase, a new triterpene synthase from Luffa cylindrica, involved in biosynthesis of bryonolic acid ppt
... introduced into the 50 and 30 -termini of the deduced ORF of LcIMS1 cDNA by PCR (25 cycles with 40 s at 94 8C, 40 s at 50 8C and at 72 8C) with Pfu DNA polymerase (Stratagene) used as the DNA polymerase ... (Pharmacia), and a Luffa cDNA library was constructed using a lZAP-cDNA synthesis kit (Stratagene) Cloning of a new triterpene synthase cDNA from L cylindrica A 1227-bp digoxigenin (DIG)-labeled DNA probe, ... cDNA was a candidate for isomultiflorenol synthase of L cylindrica Functional expression of the new OSC cDNA in the ERG7-deficient yeast mutant GIL77 To elucidate the function of the new OSC cDNA,...
Ngày tải lên: 08/03/2014, 23:20
THE MYTHS AND LEGENDS OF ANCIENT GREECE AND ROME docx
... THE SIEGE OF TROY, 283 RETURN OF THE GREEKS FROM TROY, 304 [7] MYTHS AND LEGENDS OF ANCIENT GREECE AND ROME PART I.MYTHS INTRODUCTION Before entering upon the many strange beliefs of the ancient ... the foot of the Capitoline Hill, in which were deposited the public treasury and the laws of the state RHEA (OPS) Rhea, the wife of Cronus, and mother of Zeus and the other great gods of Olympus, ... was the goddess of Justice, Law, and Order EURYNOME was one of the Oceanides, and the mother of the Charites or Graces DEMETER,[13] the daughter of Cronus and Rhea, was the goddess of Agriculture...
Ngày tải lên: 15/03/2014, 07:20
Báo cáo khoa học: Cloning and expression of a tomato cDNA encoding a methyl jasmonate cleaving esterase pdf
... electrophoresis, DNA elution and modification was carried out according to standard protocols [24] After cloning of the PCR product into the vector pGEMT (Promega) and sequencing (automated sequencer ... this was a result of Fig Tomato methyl jasmonate esterase cDNA and deduced protein sequence Peptides determined by sequencing of the purified protein are boxed and the names of the peptides are ... analysis of total genomic DNA from tomato plants Fifty micrograms of DNA was digested overnight with restriction enzymes and separated on a 1% agarose gel M, size standard; lane 1, BamHI-digested DNA; ...
Ngày tải lên: 16/03/2014, 18:20
Báo cáo khoa học: cDNA cloning and characterization of a novel calmodulinlike protein from pearl oyster Pinctada fucata potx
... to the understanding of the underlying mechanism of calcium metabolism in the process of shell and pearl formation, but also offer the opportunity to promote the yield and quality of pearl In this ... important clues to understand the diversity of calcium signaling and the complex mechanism of oyster calcium metabolism Results and Discussion Cloning of a full length cDNA encoding a calmodulin-like ... gene primers (LS11 and LS12) were synthesized and were used to amplify the 3¢ nucleotide sequence of CaLP cDNA by two rounds of nest PCR reaction The5¢ sequence of oyster CaLP cDNA was also isolated...
Ngày tải lên: 16/03/2014, 23:20
Báo cáo Y học: Cloning and expression of two novel aldo-keto reductases from Digitalis purpurea leaves potx
... protocol of Gartner et al [9] and the ¨ subsequent amino acid sequencing The second strategy is based on the use of orthologous genes for screening a cDNA library of D purpurea As such a type of steroid ... sequences were determined for both strands of the cDNAs and analysed by the DNASTAR program package (Lasergene) and CLUSTALW Plant treatments To determine the effects of several stress conditions on ... homology of DpAR1 and DpAR2 to the AKR protein superfamily Comparison of DpAR1 and DpAR2 aminoacid sequences with those of plants (Fig 1) revealed that these proteins present 80, 73, 70 and 68%...
Ngày tải lên: 18/03/2014, 01:20
Báo cáo Y học: Cloning and characterization of novel snake venom proteins that block smooth muscle contraction pptx
... 473 A and 477) cDNA cloning of proteins The cDNAs encoding tigrin, ablomin, and latisemin were obtained using the RT -PCR method Typically, venom gland total RNA was isolated from the venom gland ... obtained mg of triflin and mg of latisemin from 500 mg of crude venom, respectively The predicted amino-acid sequences of triflin and latisemin are homologous to that of ablomin (83.7 and 61.5%, ... (26 and 29.7 kDa), lanes and show triflin (23 and 29 kDa), lanes and show latisemin (28 kDa each), and lanes and show tigrin (28 and 30 kDa) The numbers on the left are relative molecular mass of...
Ngày tải lên: 18/03/2014, 01:20
Báo cáo khoa học: Molecular cloning and characterization of the crustacean hyperglycemic hormone cDNA from Litopenaeus schmitti Functional analysis by double-stranded RNA interference technique pot
... N-terminal and C-terminal regions of the mature peptide To obtain the CHH cDNA, we used 10 lg of total eyestalk RNA from adult shrimp by RT -PCR assays The quality of synthesized cDNA was confirmed by PCR ... gene Cloning of PCR amplified DNA fragment The PCR product was cloned using the pGEM-T Easy vector system I kit (Promega) Both strands of the cloned cDNA were sequenced in an automatic DNA sequencer ... amplification of L schmitti b-actin and b-tubulin partial cDNA In both cases we obtained the expected size of the amplified fragments A cDNA of 216 bp (oligonucleotides included) was amplified by PCR using...
Ngày tải lên: 23/03/2014, 10:20