path fig a8 1 a and b p 195

Báo cáo khoa học: Coordination of three and four Cu(I) to the a- and b-domain of vertebrate Zn-metallothionein-1, respectively, induces signiﬁcant structural changes doc

... distorted chair The C-terminal a- domain is characterized by an adamantane-like four-metal cluster Solution structures of 11 3 Cd-substituted Cd7MT-2 from rabbit, rat and human are available and revealed ... initial additions of Cu(I) to each domain caused the disappearance of a large set of NOESY cross-peaks and the parallel appearance of another set of cross-peaks, until a clean 2D spectrum belonging ... faint similarities of some parts of the polypeptide backbone folds could be observed Separate superpositions of stretches 3 12 , 11 –20 and 18 –28 were also attempted For both domains, the ﬁrst and...

14
485
0

600 sentences of certificate A and B

Danh mục: Cao đẳng - Đại học

... >d 18 0 I understand what you are saying a perfect b perfectly c perfection d imperfect > b 18 1 His promotion to manager was a popular ……………………………… a appoint b appointed c appointment d appointee ... it when you travel a a card b a cartel c a label d a traveling-bag > c 2 91 Last December the boss gave all his a bonus a employ b employable c employee d employees > d 292 Are you sure we're ... father a than b as c but d and > a 48 I am teacher a the b a c an d no article > b 49 My uncle is good engineer a the b a c an d no article > b 50 That is eraser a the b a c an d no article...

280
884
3

Tài liệu Báo cáo khoa học: The chitinolytic system of Lactococcus lactis ssp. lactis comprises a nonprocessive chitinase and a chitin-binding protein that promotes the degradation of a- and b-chitin doc

Danh mục: Báo cáo khoa học

... French D (19 67) Multiple attach hypothesis of alpha-amylase action: action of porcine pancreatic, human salivary, and Aspergillus oryzae alpha-amylases Arch Biochem Biophys 12 2, 816 Teeri TT (19 97) ... bind a wider variety of substrates than CBP 21 and CHB1 L lactis chitinase and chitin-binding protein 10 0 80 60 40 20 0 Fig Chitin degradation by LlChi1 8A in the absence and presence of LlCBP3 3A at ... showed that LlChi1 8A has a narrow pH activity prole with an optimum at pH 3.8 (Fig 4A) Studies on pH stability showed that the A B Fig Structural comparison of CBP 21 and LlCBP3 3A Illustrations...

14
683
0

Báo cáo khoa học: Mutual effects of proton and sodium chloride on oxygenation of liganded human hemoglobin Oxygen afﬁnities of the a and b subunits potx

Danh mục: Báo cáo khoa học

... Konovalova for preparing protein solutions This work was supported by the Belarusian Republican Foundation for Fundamental Research (Grant B0 0 -17 6) and the Belarus State Program of Basic Research ... HbA are shown in (A) and (B) , respectively Conditions: (1) 10 mM Tris ⁄ HCl buffer, pH 6.8– 8.5, at 21 °C (2) HbA modiﬁed with pyridoxal 5¢-phosphate (PLPHbA), 1. 6 mol PLP per tetrameric HbA, ... afﬁnity, K, can be derived for both the a and b subunits from the averaged parameters of HbA oxygenation (Table 1, Average) The association and dissociation rate constants for the b subunits are found...

11
577
0

The a and b adapters are used as priming sites for both amplification

Danh mục: Tin học

... Step 1: Preparation of the DNA • DNA is fragmented by nebulization • The DNA strand’s ends are made blunt with appropriate enzymes • A and B adapters are ligated to the blunt ends using DNA ... not allow more than one ssDNA bead to be loaded into a well • Enzyme beads and packing beads are added Enzyme beads containing sulfurase and luciferase, and packing beads used only to keep the ... ligase • The strands are denatured using sodium hydroxide to release the ssDNA template library (sstDNA) The Adapters • The A and B adapters are used as priming sites for both amplification and...

19
390
0

Báo cáo khoa học: Unprecedented pathogen-inducible complex oxylipins from ﬂax – linolipins A and B docx

Danh mục: Báo cáo khoa học

... Erwinia carotovora subsp atroseptica and characterization of virulence factors Proc Natl Acad Sci USA 10 1, 11 105 11 110 Supporting information The following supplementary material is available: Fig ... Oxo-phytodienoic ¨ acid-containing galactolipids in Arabidopsis: jasmonate signaling dependence Plant Physiol 14 5, 16 58 16 69 4472 47 Buseman CM, Tamura P, Sparks AA, Baughman EJ, Maatta S, Zhao ... were separated by HPLC as described below Separation of galactolipids by HPLC Galactolipids were separated by RP-HPLC on two serially connected Separon SIX columns (15 0 · mm; lm; Tessek, Praha, Czech...

10
387
0

Báo cáo khoa học: Expressed as the sole Hsp90 of yeast, the a and b isoforms of human Hsp90 differ with regard to their capacities for activation of certain client proteins, whereas only Hsp90b generates sensitivity to the Hsp90 inhibitor radicicol pdf

Danh mục: Báo cáo khoa học

... Hsp90 [16 ] Results PP30[hHsp9 0a] and PP30[hHsp9 0b] ) yeast strains that express human Hsp9 0a or Hsp9 0b as their sole Hsp90 S cerevisiae strains PP30[pHSC8 2b] , PP30[pHSP82] and PP30[hHsp9 0b] are ... efﬁciencies, both of the yeast and both of the human isoforms of Hsp90 indicated that the levels of Hsp90 expression in strains PP30[pHSC8 2b] , PP30[pHSP82], PP30[hHsp9 0a] and PP30[hHsp9 0b] were comparable, ... and PP30[hHsp9 0b] slt2D cells transformed with pG1 or pG1-ERK5 (B) Measurements of YIL 117 c-LacZ expression in PP30[hHsp9 0a] slt2D (open bars) and PP30[hHsp9 0b] slt2D (black bars) transformed with pG1-ERK5,...

11
427
0

Báo cáo khoa học: Identiﬁcation of the N-termini of NADPH : protochlorophyllide oxidoreductase A and B from barley etioplasts (Hordeum vulgare L.) ppt

Danh mục: Báo cáo khoa học

... of PORA and PORB of barley and POR from pea are homologous, and that Pchlide cannot bind to the PORA transit peptide of pPORA as recently proposed [22] Results Acetylation of the POR protein and ... 9.00 10 .00 11 .00 12 .00 13 .00 14 .00 Fig Base peak-intensity chromatogram of N-terminal and internal peptides of PORA Peptides of PORA were isolated from barley etioplasts and separated by UPLC ... import of pPORA [15 ,17 ] In favour of this hypothesis, Fig Sequence alignment of pPORA and pPORB from barley and pPOR from pea Arrowheads indicate the cleavage sites between the transit peptide and...

8
362
0

Báo cáo khoa học: Cloning of a rat gene encoding the histo-blood group A enzyme Tissue expression of the gene and of the A and B antigens potx

Danh mục: Báo cáo khoa học

... TMAP and TOPPRED2 programs Determination of the exon/ intron boundaries were obtained by analysis of the rat genomic sequences available in the NCBI database The programs used are all available ... transferase A (cis A/ B) transferase A- likea Gal transferase Gal transferase Gal transferase Gal transferase Gal transferase Gal transferase IGb3 synthetase IGb3 synthetase Forssman synthetasea ... White, T., Clausen, H & Hakomori, S.I (19 90) Cloning and characterization of DNA complementary to human UDP-GalNAc: Fuca1–2Gala1–3GalNAc transferase (histo-blood group A transferase) mRNA J Biol Chem...

8
499
0

Báo cáo khoa học: Characterization of the 5¢ untranslated region of a and b isoforms of the human thromboxane A2 receptor (TP) Differential promoter utilization by the TP isoforms doc

Danh mục: Báo cáo khoa học

... generate the recombinant plasmids pGL 3b: Prm1; pGL 3b: Prm2 and pGL 3b: Prm3, each in pGL3Basic and pGL3e:Prm1; pGL3e:Prm2 and pGL3e:Prm3, each in pGL3Enhancer The ﬁdelity of all recombinant plasmids ... to amplify 13 21 bp TPa fragment containing E 1b & E2; lane 4, Kin130/Kin 21 predicted to amplify 11 90 bp TPb fragment containing E 1b & E2; lane 5, Kin45/Kin75 predicted to amplify 10 40 bp TPa fragment ... cDNA templates (lanes 1 7 and lane 10 ) and pBluescript II KS(–):TPb [4] (lanes 8–9): lane 1, Kin46/Kin75 predicted to amplify a 11 34 bp fragment; lane 2, Kin46/Kin 21 predicted to amplify 10 03 bp...

16
321
0

Báo cáo sinh học: " Open Access Cloning of the canine RNA polymerase I promoter and establishment of reverse genetics for influenza A and B in MDCK cells" docx

Danh mục: Hóa học - Dầu khí

... XbaI BamHI BamHI BamHI AvrII SpeI EcoRI SpeI HindIII SphI XbaI XbaI BamHI * XbaI BamHI BamHI SacI BamHI * EcoRI BamHI SacI BamHI BamHI AvrII 18 S rRNA Gene MDCK Eco RI 7 .1 kb Fragment B M C M Probe ... Xenopus Rat TATTGGACCTGGAGATAGGTACTGACACGC Mouse TTTGGGCCGCCGGGTTATATGCTGACACGC 216 bases TGCCTTATATGTTCGTCTGTAGGAGCGAGT GCATGTGCGGGCAGGAAGGTAGGGGAAGAC GATC Drosophila TATTGTACCTGGAGATATATGCTGACACGC ... http://www.virologyj.com/content/4 /1/ 102 A C T 18 03 G 18 04 C 18 05 pK9GFP 1- 1802(T) pK9GFP 1- 1803(G) EcoR I pK9GFP 1- 1803(G) pK9GFP 1- 1804(C) p HW72-EGFP pCMV EGFP BamH I promoter TIS( +1) pK9Pol I EB B pK9GFP 1- 1802(T) pK9GFP 1- 1803(G)...

12
567
0

Báo cáo hóa học: " Cloning of the canine RNA polymerase I promoter and establishment of reverse genetics for influenza A and B in MDCK cells" pdf

Danh mục: Hóa học - Dầu khí

... XbaI BamHI BamHI BamHI AvrII SpeI EcoRI SpeI HindIII SphI XbaI XbaI BamHI * XbaI BamHI BamHI SacI BamHI * EcoRI BamHI SacI BamHI BamHI AvrII 18 S rRNA Gene MDCK Eco RI 7 .1 kb Fragment B M C M Probe ... Xenopus Rat TATTGGACCTGGAGATAGGTACTGACACGC Mouse TTTGGGCCGCCGGGTTATATGCTGACACGC 216 bases TGCCTTATATGTTCGTCTGTAGGAGCGAGT GCATGTGCGGGCAGGAAGGTAGGGGAAGAC GATC Drosophila TATTGTACCTGGAGATATATGCTGACACGC ... http://www.virologyj.com/content/4 /1/ 102 A C T 18 03 G 18 04 C 18 05 pK9GFP 1- 1802(T) pK9GFP 1- 1803(G) EcoR I pK9GFP 1- 1803(G) pK9GFP 1- 1804(C) p HW72-EGFP pCMV EGFP BamH I promoter TIS( +1) pK9Pol I EB B pK9GFP 1- 1802(T) pK9GFP 1- 1803(G)...

12
627
0

2000 Test exam with A and B docx

Danh mục: Chứng chỉ A, B, C

... c perfection d imperfect > b 18 1 His promotion to manager was a popular ……………………………… a appoint b appointed c appointment d appointee > c 18 2 A holiday in America can be cheap a surprise b ... c an d some > c 13 4 What is color of your pen? a the b a c an d any > a 13 5 Kate and Mary are going to cinema a the b a c an d no article > a 13 6 My parents are always at home on Sundays ... million pounds from a bank a crime b criminal c criminally d criminality > b 17 8 your own business can cause a lot of financial worries a Manage b Managing c Manager d Manageable > b 17 9 The...

281
349
0

Báo cáo toán học: "Parking functions of types A and B" ppsx

Danh mục: Báo cáo khoa học

... Since a1 , , an 1 ≤ an , relabeling an + 2, , n + as an + 1, , n, we see by induction hypothesis that there is a unique factorization (1 an an + n + 1) = (a1 b1 ) (a2 b2 ) (an 1 bn 1 ... consider (a1 , , an ) a nondecreasing parking function If it comes from some factorization (a1 b1 ) (an bn ), then bn = an + as we just saw But (a1 , , an 1 ) is a non-decreasing parking ... the product of at most k − reﬂections References [B1 ] P Biane, Some properties of crossings and partitions Discrete Math 17 5 (19 97), no 1- 3, 41 53 [B2 ] P Biane, Minimal factorizations of a cycle...

5
367
0

Báo cáo y học: " Hemoglobin a and b are ubiquitous in the human lung, decline in idiopathic pulmonary fibrosis but not in COPD" potx

Danh mục: Báo cáo khoa học

... in a semiquantitative manner by Western Ishikawa et al Respiratory Research 2 010 , 11 :12 3 http://respiratory-research.com/content /11 /1/ 123 Page of 13 Figure Hba and Hbb expression and localization ... vary in airway and Ishikawa et al Respiratory Research 2 010 , 11 :12 3 http://respiratory-research.com/content /11 /1/ 123 parenchymal lung diseases including COPD [10 ,11 ], equal loading was standardized ... inflammatory diseases where oxygen transport/saturation and exchange are disturbed Page 11 of 13 Additional material Additional file 1: Table S1 Detailed data of the morphometrical analysis of Hba and...

13
349
0

Synthetic progress toward parvistemonine, spiroxins a and b, and generation of palmarumycin analogues

Danh mục: Hóa học

... acetal 16 1 Scheme 11 .16 Failed protection of 238 with bridging silane 16 1 Scheme 11 .17 Acetate protected naphthol 229 in spiroketalization 16 2 xv Scheme 11 .18 Silylation and debenzylation ... 10 8 9.6.2 Carbohydrate linked prodrugs 11 1 9.6.3 Biological data for generation II prodrugs 11 6 10 .0 SYNTHESIS OF 17 7 & PRODRUGS EXPERIMENTAL PART 11 9 11 .0 PRODRUG SCALE-UP ... BUILDING BLOCKS 15 3 11 .5 SYNTHESIS AND PROTECTION OF NAPHTHOL 238 15 6 11 .5 .1 Naphthosultone starting material 15 6 11 .5.2 Acetonide protection of 238 15 8 11 .5.3 Spiroketalization...

289
518
0

A STUDY IN THE SELECTIVE POLYMORPHISM OF a AND b GLYCINE IN PURE AND MIXED SOLVENT

Danh mục: Cao đẳng - Đại học

... Appendix A. 2: Interfacial Analysis 14 4 Appendix A. 3: Simulation in Bulk Solution 14 8 Appendix A. 4: Simulation at the Interface 14 9 Appendix A. 5: Further elaboration ... DNP Double-Numerical plus d- and p- Polarization basis set ESP Electrostatic Potential RESP Restrained Electrostatic Potential 13 TIP Transferable Intermolecular Potential Functions NPT Fixed pressure ... or packaging of material Polymorphism of a crystalline material can also affect its solid-state properties The dissolution rate and bioavailability of potential drugs, for example, are dependent...

170
358
0

Electrical, dielectric and magnetocaloric properties of selected a and b site substituted manganites

Danh mục: Thạc sĩ - Cao học

... Bandana Mahakud and Mrs Sujata Biswal), Brother-in-laws (Mr Dibakar Barik, Mr Manoranjan Mahakud, Dr Ramesh Biswal and Mr Kharabela Behera), sister in laws (Mrs Tanaya Barik and Mrs Rebati Barik) ... enjoyable I am also thankful to Mr Prasanta Sahani, Mr Sashi Bhusan Rout, Mr Satyananda Kar, Mr Satyananda Barik, Mr Rajeeb kumar Jena, Mr Narahari Mahanta, Mr Bijay Kumar Das, Mr Satyanarayan Bhuyan, ... Pagili Barik), Father-in-law (Dr Dasarathi Behera), Mother- in-law (Mrs Golap Manjari Behera), Brothers (Dr Subrat Kumar Barik and Mr Ratikanta Barik), Sisters (Mrs Saroj Bala Barik, Mrs i ACKNOWLEDGEMENTS...

242
417
0