Ngày tải lên: 12/07/2014, 01:20
Ngày tải lên: 12/07/2014, 01:20
Bài 1 - The parts of a letter (Thành phần của một bức thư)-phần3 pdf
Ngày tải lên: 12/07/2014, 01:20
Tài liệu Báo cáo " synthesis, cloning and expression in escherichia coli of a gene coding for Mcoti-ii " ppt
... tgccaccgct gagcaataac 32 0 32 1 tagcataccc cttggggcct ctaaacgggt cttgaggggt 36 0 36 1 TTTTTGCTGA AAGGAGGAAC TATATCCGGA TATCCCGCAA 400 401 GAGCCCGGCA GTACCGGCAT AACCAAGCCT ATGCCTACAG 440 441 CATCCAGGGT ... 161 gaaaaaatgc cgccgcgata gcgattgccc gggcgcgtca 200 201 tttgccgcgg caacggctat tgcggctaac tcgagcccgg 240 241 gtgactgcag gaaggggatc cggctgctaa caaagcccga 280 281 aaggaagctg agttggctgc tgccaccgct ... Gctcgcggat ttatttcgag ttcagacctg ttcagacctg 40 41 ttattatggg tattacttta tctgatgatt ctgaTcatca 80 81 Gtttttgctt ggatcccagg ttgttgtaca gaatgctggt 120 121 catatgagcg gcagcgatgg cggcgtgtgc cgaaaattct...
Ngày tải lên: 12/02/2014, 10:20
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf
... 5Â-CTC GAGATGGATAAAGTTTTAAACAGAG -3 and LTA- 1R, 5Â-TGAAGGCAAATCTCTGGAC -3 for the former, and LTAM2F, 5Â-CAGCTGTTTTGCTTGAATTATG -3 and LTA2R, 5Â-GAATTCATTATGTTTCAGGTTCA GGGG -3 for the latter. The ... long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse Takashi Yamaguchi, Taeko Ichise, Osamu Iwata, Akiko Hori, Tomomi Adachi, Masaru Nakamura, Nobuaki Yoshida and ... medulla and interstitial cells of the cardiac valve. Arrowheads indicate CD31-positive ECs (green). All micrographs are shown at the same magnification. Scale bar = 50 lm. A new method for mouse...
Ngày tải lên: 18/02/2014, 17:20
Báo cáo "Development of a software package for 3D structured mesh generation " pdf
... 4.1. The graphic user interface of the package The package is designed with a main interface that allows users to input topographical elevation data of the top (upper) surface of any 3D objects ... viewing and presenting the topographic data and the generated meshes. The package has been applied to the generation of 3D computational meshes used as the input of a computational fluid dynamics ... data and the output meshes. The software package has been initially used as a tool for 3D structured mesh generation for simulations of compressible turbulent atmospheric flows and air quality...
Ngày tải lên: 14/03/2014, 13:20
Báo cáo khoa học: "Automatic Induction of a CCG Grammar for Turkish" pptx
... 1999. Head-driven Statistical Models for Natural Language Parsing. Ph.D. thesis, Univer- sity of Pennsylvania. Julia Hockenmaier. 20 03. Data Models for statisti- cal parsing with Combinatory Categorial ... Categorial Grammar. Ph.D. thesis, University of Edinburgh. Yehoshua Bar-Hillel, C. Gaifman, and E. Shamir. 1964. On categorial and phrase structure grammars. In Language and Information ed. Bar-Hillel, ... et al., 20 03; Oflazer et al., 20 03) . The samples in the corpus are taken from 3 daily newspapers, 87 journal issues and 201 books. The treebank has 5 635 sentences.There are a total of 539 93 tokens....
Ngày tải lên: 17/03/2014, 06:20
Báo cáo khoa học: "PEAS, the first instantiation of a comparative framework for evaluating parsers of French" potx
... France {gendner,gabrieli,jardino,monceaux,pap,isabelle,anne}@limsi.fr Abstract This paper presents PEAS, the first comparative evaluation framework for parsers of French whose annotation formalism allows the annotation of both constituents and functional relations. ... Annotation formalism The definition of the annotation formalism is the core element of the evaluation process. Indeed, the formalism must have a coverage of syntactical phenomena as broad as possible ... Therefore, the need for a complete comparative evaluation framework — including a pivot annotation formalism, a reference treebank, evaluation metrics and the associated software — is increasing. It is...
Ngày tải lên: 17/03/2014, 22:20
Báo cáo khoa học: Inhibition of a-synuclein fibrillization by dopamine analogs via reaction with the amino groups of a-synuclein Implication for dopaminergic neurodegeneration pot
... reactions of DA analogs with a- Syn and some amino acids. (A) UV-vis spectra of a- Syn with DA, CA, HQ and Q after reaction for 24 h. The a- Syn alone sample was as a control. The concentration of a- Syn ... Biological Sciences, Chinese Academy of Sciences, Shanghai, China 2 Shanghai Institute of Materia Medica, Shanghai, China 3 Shanghai Institute of Nuclear Research, Shanghai, China 4 Bio-X Research ... oligomerization of a- Syn by DA analogs. (A) SEC analysis of the reaction products showing the large molecular mass fractions. The graphs display incubation of a- Syn alone (black), the reactions of a- Syn...
Ngày tải lên: 23/03/2014, 15:20
Báo cáo khoa học: "The Design of a Computer Language for Linguistic Information" ppt
... International and Center for the Study of Language and Information Stanford University Abstract A considerable body of accumulated knowledge about the design of languages for communicating ... structs Clearly, the bare PATR-II formalism, as it was pre- sented in Section 2.1, is sorely inadequate for any major attempt at building natural-language grammars because of its verbosity and redundancy. ... Denotational Semantics One reason for maintaining the simplicity of the bare PATR-II formalism is to permit a clean semantics for the language. We have provided a denotational semantics for PATR-ll...
Ngày tải lên: 24/03/2014, 01:21
Evaluation of a diagnostic algorithm for smear-negative pulmonary tuberculosis in HIV-infected adults doc
... DipHIVMan (SA) Objectives. To evaluate the diagnostic accuracy of and reduction in diagnostic delay attributable to a clinical algorithm used for the diagnosis of smear-negative pulmonary tuberculosis ... 10: 31 -38 . 19. Hargreaves NJ, Kadzakumanja O, Phiri S, et al. What causes smear-negative pulmonary tuberculosis in Malawian area of high HIV seroprevalence? Int J Tuberc Lung Dis 2001; 5: 1 13- 122. 20. ... radiograph; ADA = adenosine deaminase; CRP = C-reactive protein; Hb = haemoglobin. 5 probable TB ‡ cases (3 had military patterns on CXR, and 2 had high ADA levels in pleural effusion, all...
Ngày tải lên: 29/03/2014, 03:20
Báo cáo hóa học: " Development and application of a biomarker assay for determining the pharmacodynamic activity of an antagonist candidate biotherapeutic antibody to IL21R in whole blood" pptx
... required upon hand-off for assay validation. SJ, AW, SWA and KA performed the in vitro assays on mon- keys treated with Ab-01 and control Ig and analyzed the data, and KA and SA performed the experiments ... housed and cared for according to the American Association for Accreditation of Laboratory Animal Care guidelines. The Wyeth Institutional Animal Arai et al. Journal of Translational Medicine 2010, ... LaVallie 1 , Deborah Young 3 , Laird Bloom 1 , Karissa Adkins 6 and Margot O'Toole* 7 Abstract Background: In preparation for potential clinical development of Ab-01, an antagonistic antibody...
Ngày tải lên: 18/06/2014, 16:20
Báo cáo hóa học: " Development of a mathematical model for predicting electrically elicited quadriceps femoris muscle forces during isovelocity knee joint motion" potx
... University of Delaware, Newark, DE, USA and 2 Department of Mechanical and Aeronautical Engineering, Civil and Environmental Engineering, and Land, Air, and Water Resources, University of California, ... dominated by parameters A 40 and τ 2 (Fig. 6). For example, at a short- ening speed of 200°/s parameters A 40 and τ 2 account for ~25% and ~56% of the output variance, respectively. In addition, ... Heckman and colleagues [31 ] and de Haan [32 ] showed that in cat and rat medial gastrocne- mius muscle, the force-velocity relation was affected by stimulation frequency. Hence, to account for...
Ngày tải lên: 19/06/2014, 08:20
báo cáo hóa học: " Rehabilitation robotics: pilot trial of a spatial extension for MIT-Manus" pdf
... MIT's module can be operated in stan- dalone fashion or integrated to the planar MIT-MANUS to allow spatial movements. Note that in the standalone fashion it can be operated at any angle ... develop- ment and application of robotics as a therapy aid, and in particular a tool for therapists. We foresee robots and computers as supporting and enhancing the productivity of clinicians in their efforts ... stan- dalone fashion or integrated to the planar MIT-MANUS to allow spatial movements. Note that in the standalone fashion it can be operated at any angle to the horizontal and vertical planes with adjustable...
Ngày tải lên: 19/06/2014, 10:20
Báo cáo hóa học: " Strong convergence of a hybrid method for monotone variational inequalities and fixed point problems" ppt
... University, Kaohsiung 833 , Taiwan 3 Department of Applied Mathematics, Chung Yuan Christian University, Chung Li 32 0 23, Taiwan 4 Center for General Education, Kaohsiung Medical University, Kaohsiung 807, ... proximal-extragradient type method for monotone variational inequalities. J Math Anal Appl. 30 0, 36 2 37 4 (2004). doi:10.1016/j.jmaa.2004.04.068 15. Facchinei, F, Pang, JS: Finite-dimensional variational ... Taiwan Full list of author information is available at the end of the article Abstract In this paper, we suggest a hybrid method for finding a common element of the set of solution of a monotone,...
Ngày tải lên: 20/06/2014, 22:20
Báo cáo hóa học: "Setup, efforts and practical experiences of a monitoring program for genetically modified plants - an Austrian case study for oilseed rape and maize" pptx
... http://www.eea. europa.eu/data-and-maps/data/eea-reference-grids which is used as the standard reference grid for all spatial sta- tistic data in Austria. Hence, we have a direct spatial link between ... area -Grassland cover -Average annual temperature -Average annual precipitation Spatial layers of these variables were intersected with our sample grid in a geographic information system [GIS], and ... 271:1909-1916. 22. Saji H, Nakajima N, Aono M, Tamaoki M, Kubo K, Wakiyama S, Hatase Y, Nagatsu M: Monitori ng the escape of transgenic oilseed rape around Japanese ports and roadsi des. Environ Biosafety...
Ngày tải lên: 21/06/2014, 05:20
Báo cáo hóa học: " Application of a MANET Testbed for horizontal and vertical scenarios: performance evaluation using delay and jitter metrics" potx
... Ikeda M, De Marco G, Durresi A, Xhafa F (2009) Performance Analysis of OLSR and BATMAN Protocols Considering Link Quality Parameter. Proc. of IEEE AINA-2009 30 7 31 4 11. Kulla E, Ikeda M, Barolli ... Performance Evaluation of a MANET Testbed for Differenet Topologies. Proc. of NBiS-2009, Indianapolis 32 7 33 4 13. Ikeda M, Barolli L, De Marco G, Yang T, Durresi A (2008) Experimental and Simulation ... 2011, 1 :3 http://www.hcis-journal.com/content/1/1 /3 Page 2 of 14 RESEARCH Open Access Application of a MANET Testbed for horizontal and vertical scenarios: performance evaluation using delay and...
Ngày tải lên: 21/06/2014, 06:20
Báo cáo hóa học: " Research Article Experimental Characterization of a UWB Channel for Body Area Networks" potx
... near the human are characterized. The frequency- and distance- dependent characteristics of a UWB channel are analyzed in this paper, where an NLOS channel is shown to have larger path loss than ... on-body. spread, RMS delay spread, and maximum delay spread are three multipath channel parameters that can be determined from the power delay profile [20]. Mean delay spread is the average delay weighted ... 802.15.04-0662-01-00 4a, Novemebr 2004. [10] Q. Wang, T. Tayamachi, I. Kimura, and J. Wang, “An on- body channel model for UWB body area communications for various postures,” IEEE Transactions on Antennas and Propagation,...
Ngày tải lên: 21/06/2014, 07:20