p014c p014d p015a p015b a f sensor 1

Tài liệu A WIRELESS SENSOR NETWORK AIR POLLUTION MONITORING SYSTEM pdf

Ngày tải lên : 17/02/2014, 22:20

... and the health concern in this area as shown in figure 11 below Figure 11 AQI for a selected area 41 Furthermore, the WAPMS system allows fast analysis of received data through line graphs of ... selected areas as shown in figure 12 Figure 12 Line graph generated for selected areas The performance of WAPMS has been evaluation with increasing load We have varied the number of areas simulated from ... Initiator: The java DriverManager allows for a method to open a database, providing it the name of the database, user name and password as parameters So, this component just has to make a call...

15
365
1

Northwest A&F University The program of Agricultural Economic Management Master''''s degree pptx

Ngày tải lên : 23/03/2014, 19:20

... Writing graduate papers is an important part of training postgraduate It is main process of training postgraduate to innovate, using professional knowledge to discovery problems, analyze and solve ... subjects: Apart from the politics, foreign languages, mathematics three public examinations, professional examination subjects are Western Economics and Management Principles Learning Postgraduate ... before graduating in early December if you can not graduate for special reasons For full-time postgraduate, the early reply period will not exceed six months, for serving postgraduate, the early...

6
324
0

báo cáo hóa học: " In vitro and in vivo pre-clinical analysis of a F(ab’)2 fragment of panitumumab for molecular imaging and therapy of HER1-positive cancers" pot

Ngày tải lên : 21/06/2014, 02:20

... tomography The Fab fragment was Wong et al EJNMMI Research 2 011 , 1: 1 http://www.ejnmmires.com/content /1/ 1 /1 Page of 15 Table Biphasic analysis of blood pharmacokinetics of 11 1 In- CHX -A" -panitumumab ... 38 28 17 14 Non-Reduced Reduced Figure SDS-PAGE analysis of panitumumab F( ab’)2 The panitumumab F( ab’)2 was evaluated by SDS-PAGE before (a) and after (b) the final step of buffer exchange and ... characterization of panitumumab F( ab’) fragment with an emphasis on its evaluation towards both imaging and therapeutic applications Materials and methods Preparation of F( ab’)2 fragments Panitumumab (Amgen)...

15
452
0

Báo cáo hóa học: " Research Article A Wireless Sensor Network for RF-Based Indoor Localization" pptx

Ngày tải lên : 21/06/2014, 22:20

... dictate the usage of LocMAC relay LocMAC relay provides localization data aggregation and low-latency data relay It is primarily designed for multihop data gathering using LocMAC base as the data ... Both LBs and LBAs include payload parts Uplink data can be piggybagged in LB frames, while downlink data can utilize LBA frames Two quality-of-service (QoS) classes, datagram and reliable, are supported ... relay nodes form a ﬂat topology to enable data forwarding to the sink(s) For data aggregation, clusters are established Each aggregation cluster consists of an aggregation cluster head (ACH) and...

27
411
0

Báo cáo hóa học: " A pH sensor based on electric properties of nanotubes on a glass substrate" pptx

Ngày tải lên : 22/06/2014, 18:20

... layer of APS After deposition of the source and drain electrodes, the top gate was fabricated on a 500-nm-thick APS layer on nanotubes and source and drain electrodes (Fig 1f) We used APS as an ... using a spincoater Pairs of areas were fabricated in the PMMA ﬁlm using photolithography and ordered pairs of electrode patterns were obtained (Fig 1a) A 1% APS solution was dropped on the substrate ... Chemical Co Inc., Japan Cover glass was purchased from Matsunami Glass Ind., Ltd., Japan A photoresist (OFPR-800) was purchased from Tokyo Ohka Kogyo Co., Ltd., Japan CNT immobilization on glass Fabrication...

6
346
0

Báo cáo hóa học: " Minimum Energy Decentralized Estimation in a Wireless Sensor Network with Correlated Sensor Noises" pot

Ngày tải lên : 23/06/2014, 00:20

... China, in 19 84 During the academic year of 19 84 /19 85, he was with Nankai Institute of Mathematics, Tianjin, China From 19 85 to 19 89, he studied at the Department of Electrical Engineering and ... Hamilton, Canada, where he became a Professor in 19 98 and held the Canada Research Chair in information processing since 20 01 Starting April 2003, he has been a Professor in the Department of ... research is supported in part by the Natural Sciences and Engineering Research Council of Canada, Grant no OPG00903 91, by the Canada Research Chair Program, and by the National Science Foundation,...

10
197
0

Báo cáo hóa học: " A Two-Sensor Noise Reduction System: Applications for Hands-Free Car Kit" ppt

Ngày tải lên : 23/06/2014, 01:20

... 11 26 EURASIP Journal on Applied Signal Processing n1 (k) X1 ( f , p) x1 (k) ˆ S1 ( f , p) FFT s1 (k) s2 (k) x (k) ˆ s1 (k) IFFT OLA Attenuation law G( f , p) FFT X2 ( f , p) n2 (k) Figure 1: ... by capitals, and indexed by p, the frame number, and f , the frequency (e.g., N1 ( f , p) for n1 (k) STFT of pth frame at frequency f ) The quantity G( f , p) represents the ﬁltering gain applied ... SNRpost ( f , p) = X1 ( f , p)X2 ( f , p) γn1 ( f , p − 1) γn2 ( f , p − 1) (10 ) and takes values in the interval ]0, +∞[ Constants b, g, and L parameterize the α(·) function Note that, for high values...

10
225
0

Báo cáo hóa học: " Preprocessing in a Tiered Sensor Network for Habitat Monitoring" doc

Ngày tải lên : 23/06/2014, 01:20

... separated In each sensor patch, a gateway node transmits data from the patch to a base station that serves the collection of patches The base station transmits all data to a central database ... 0.5 1 0 .1 0.2 0.3 0.4 0.5 0 Record TDOA from raw waveforms (sample interval) TDOA from coarse waveforms (sample interval) S1 /V1 S2 S3 S4 V2 V3 V4 2 61 2 61 2 61 2 61 2 61 2 61 2 61 2 61 2 61 2 61 2 61 262 ... their sensor network All data is transmitted back to a central database for oﬀ-line data mining and analysis It is feasible to transmit data sampled at those relatively low rates all the way back...

10
300
0

Báo cáo y học: " Use of conventional and alternative treatment strategies for a case of low back pain in a F/A-18 aviator" pdf

Ngày tải lên : 13/08/2014, 14:20

... Ultimate back fitness and performance Waterloo: Wabuno Pub; 2004 Kikukawa A, Tachibana S, Yagura S: G-related musculoskeletal spine symptoms in Japan Air Self Defense Force F- 15 pilots Aviat Space ... Med 19 96, 16 1:755-759 Price DD, McGrath PA, Rafii A, Buckingham B: The validation of visual analogue scales as ratio scale measures for chronic and experimental pain Pain 19 83, 17 :45-46 Roland ... Simon-Arndt CM, Yuan H, Hourani LL: Aircraft type and diagnosed back disorders in US Navy pilots and aircrew Aviat Space Environ Med 19 97, 68 :10 12 -10 18 Froom P, Barzilay S, Caine Y, Margaliot S, Forecast...

6
375
0

Báo cáo y học: "A pathway sensor for genome-wide screens of intracellular proteolytic cleavage" ppt

Ngày tải lên : 14/08/2014, 08:21

... HindIII and NotI sites in pEAK12 using primers 5'GACAAGCTTATGGATGATGATATCGCC-3' and 5'-GACGCGGCCGCTTAGAATTCGAAGCATTTGCGGTG-3' dNGLUC was amplified by PCR using primers 5'-GACGAATTCATGCTAGCCAAGCCCACCG-3' ... 5'AATTGGACGAGGTGGACGGCGACGAGGTGGACGGCGACTACAAGGACGA CGACGACAAGGAATTCGC-3' and 5'GGCCGCGAATTCCTTGTCGTCGTCGTCCTTGTAGTCGCCGTCCACCTCGTC GCCGTCCACCTCGTCC-3' to generate pEAK12-Actin-DEVDG2flag-dNGLUC ... activity in SN 40 30 20 10 Casp8: 12 0 01 1 Casp9: 01 1 (c) 62 kDa 47.5 kDa * 62 kDa 47.5 kDa * Casp9 GFP Figure Design of a GLUC-based caspase sensor Design of a GLUC-based caspase sensor (a) ...

11
278
0

xác định hàm lượng kim loại nặng kẽm, mangan trong một số loại rau xanh tại huyện đại từ- tỉnh thái nguyên bằng phương pháp phổ hấp thụ nguyên tử ngọn lửa (f-aas)

Ngày tải lên : 05/10/2014, 06:35

... bỡnh Sai s (%RSD) 0 ,10 9 0 ,11 3 0 ,11 6 0 ,12 3 0 ,12 3 0 ,12 1 2, 81 1,36 0,52 0,94 1, 41 1,72 Ln 0 ,10 2 0 ,11 4 0 ,11 4 0 ,11 6 0 ,12 1 0 ,12 0 Ln 0 ,10 5 0 ,11 2 0 ,11 4 0 ,11 5 0 ,12 2 0 ,12 3 Ln 0 ,10 4 0 ,11 4 0 ,11 3 0 ,11 4 0 ,12 0 ... hng ca cỏc loi axit v nng axit ti phộp o Zn Nng axit (C%) Ln 0 ,10 8 0 ,11 3 0 ,11 6 0 ,12 4 0 ,12 2 0 .11 9 Ln HNO3 0 ,10 6 0 ,11 1 0 ,11 6 0 ,12 2 0 ,12 2 0 ,12 2 Ln 0 ,11 2 0 ,11 4 0 ,11 5 0 ,12 3 0 ,12 5 0 ,12 3 S h a bi ... Zn I (mA) 60% Imax 65% Imax 70% Imax 75% Imax 80% Imax Ln 0 ,19 2 0 ,16 4 0 ,14 4 0 ,14 9 0 ,15 0 Ln 0 ,18 4 0 ,15 9 0 ,14 1 0 ,14 8 0 ,15 3 Ln 0 ,17 6 0 ,15 7 0 ,14 7 0 ,14 9 0 ,15 0 TB 0 ,18 4 0 ,16 0 0 ,14 4 0 ,14 9 0 ,15 1 %RSD...

96
1K
9

Tông quan về công tác kế toán của Công ty cổ phần kiến trúc G.A.F

Ngày tải lên : 31/03/2015, 12:01

... 10 /10 BHTT12 /11 12 /10 BHTT13 /11 15 /10 BHTT14 /11 S d u kỡ: Din gii TK PS n PS cú [GTGT u chi 11 11 1.790.0000 tit] Thu tin t thit k nh dõn ca A. Quang ( Anh Quang) [GTGT u chi 11 11 4. 816 .000 ... 6,96 -12 5083850 -11 ,285 Cng TS 15 109023409 10 0 14 12578 317 4 10 0 -983240235 -6,508 2862404597 18 ,95 506064246 3,58 -23263403 51 - 81, 27 4,Vn CSH 12 246 618 812 81, 05 13 619 718 928 96,42 13 7 310 011 6 11 , 21 Cng ... khon 11 2 CễNG TY C PHN KIN TRC G .A. F B6- TT2- Bc Linh m- P.i Kim- Q Hong Mai- H Ni S CHI TIT TI KHON T ngy 01/ 10/2 011 n ngy 31/ 10/2 011 Ti khon 11 2- Tin gi ngõn hng Ngy 08 /10 18 /10 18 /10 20 /10 S...

52
444
0

luận văn kế toán TỔNG QUAN CÔNG TÁC KẾ TOÁN TẠI CÔNG TY CỔ PHẦN KIẾN TRÚC G.A.F

Ngày tải lên : 24/05/2015, 09:08

... 12 246 618 812 81, 05 13 619 718 928 96,42 13 7 310 011 6 11 , 21 Cộng NV 15 109023409 10 0 14 12578 317 4 10 0 -983240235 -6,508 Nợ phải trả (Nguồn : Bảng cân đối kế toán năm 2 011 , Công ty CP kiến trúc G .A. F ) Phân ... Chênh Chỉ tiâu ĐVT Năm 2 010 Năm 2 011 lệch 2 011 /2 010 12 .246. 618 . 812 1. Tỉ suất tài trợ % = 81, 05 13 . 619 . 718 .928 15 .10 9.02 3.409 = 96,42 15 ,37% 14 .12 5.7 83 .17 4 1. 108.440.275 2.Tỉ suất đầu tư % 5.Khả ... -85 815 6385 -6 ,12 9 2.TSDH 11 08440275 7,34 983356425 6,96 -12 5083850 -11 ,285 Cộng TS 15 109023409 10 0 14 12578 317 4 10 0 -983240235 -6,508 2862404597 18 ,95 506064246 3,58 -23263403 51 - 81, 27 4,Vốn CSH 12 246 618 812 ...

76
517
0

SOCIAL INTERACTION ANALYSIS USING a MULTI SENSOR APPROACH

Ngày tải lên : 08/09/2015, 15:34

... 2 013 ], attraction estimation in [Ranganath, Jurafsky, and McFarland, 2009; Veenstra and Hung, 2 011 ], and social group estimation in [Hung and Kr¨se, o 2 011 ; Cristani et al., 2 011 ; Bazzani et al., ... and multi-modality ambient and wearable sensors 1. 1 .1 Social Interaction Analysis with Ambient Sensors Traditional social interaction analysis work makes use of the existing facilities such as ... level from audio-visual data In addition, human attraction estimation has been investigated in the context of Speed-Dating applications for giving feedback by analyzing behavior [Ranganath, Jurafsky,...

161
348
0

A multi sensor approach for reverse engineering of an object

Ngày tải lên : 16/09/2015, 14:04

... z s1 zs2 z s3 zs4 1 ⎟ 1 1 ⎟ 1 ⎠ ′ ( 3 .1 ) Chapter Methodology for Part Digitization ⎡ a1 1 a where ⎢ 21 ⎢ a3 1 ⎢ ⎣0 a1 2 a 22 a1 3 a 23 a3 2 a3 3 a1 4 ⎤ a 24 ⎥ ⎥ is the transformation matrix a3 4 ... 29 Figure 3 .10 Baseplate used for transformation 30 Figure 3 .11 Four chosen points for transformation . 31 Figure 3 .12 Characteristics of the planes for identification 31 Figure ... selected as a mathematical basis for region separation Hamman (19 94) presented a method for the approximation of principal curvatures at 3-surface points where the normal vectors of each 3-surface...

110
304
0

SOCIAL INTERACTION ANALYSIS USING a MULTI SENSOR APPROACH

Ngày tải lên : 30/09/2015, 09:22

... attraction estimation in [Ranganath, Jurafsky, and McFarland, 2009; Veenstra and Hung, 2 011 ], and social group estimation in [Hung and Kr¨ose, 2 011 ; Cristani et al., 2 011 ; Bazzani et al., 2 013 ] ... type, data modality, and concept to be analyzed 11 3 Average classification accuracy on body language category 11 4 Average classification accuracy on speaker’s attention ... computational component [Hummon and Fararo, 19 95] Advanced computational systems enable a variety of techniques to collect, manage and analyze this vast array of information, to address important social...

161
357
0

Tiếng Anh chuyên ngành ô tô (A-F)

Ngày tải lên : 21/10/2015, 07:07

... xả F FEEPROM (Flash electrically erasable programmable read only memory)Bộ nhớ đọc lập trình cách tự động x a FEPROM (Flash erasable programmable read only memory) Bộ nhớ đọc lập trình x a FF ... (Bottom dead center) Điểm chết BHP (Brake Horse Power) Áp lực phanh C Carburettor Bộ chế h a khí Camshaft Trục cam Camshaft position Vị trí trục cam Camshaft position sensor Cảm biến trục cam Cap Sub ... Engine, assy partial Cụm động Erasable programmable read only memory Bộ nhớ lập trình x a Evaporative emission system Hệ thống chuyển tải khí xả Exhaust gas re circulation control-BPT valve Van điều...

6
988
12

Lý luận và thực tiễn thuần hóa thủy sinh vật a f karpevits; người dịch vũ dũng tiến, lăng văn kẻn

Ngày tải lên : 17/09/2016, 19:48

... 12 0 12 — 12 ,5 0 11 — 13 0 11 - 0 -11 — 37 ■ỷ 9 15 — 37 ^ 11 ,5— 37 V 12 — 14 > 2 14 2 13 — 13 2—40 — 40 12 -40 12 — 40 ồ- ' - 18 — — 10 —36 18 —36 ^ 18 — ? ■— — 10 •¥- 36 18 — 36 *O -1* ■ >-*« Lồi ... Kaxpia Aral biên Aral 3 ,16 0 ,10 33 0,74 5,74 0,007 3,038 1, 95 0,097 0, 41 0,46 3, 01 0 01 69 0 ,17 28,27 0, 61 7,60 13 ,68 ¿9 ,17 — 19 ,78 0, 91* 8,78 ■— 10 ,6 0, 21 12,94 — — hồ Balkhas đơng 33,4 — 11 ,9 ... 0— 1, 5 0— 0- 0— - 0— 9 12 0—7,5 0—7,5 — 7' — 7 - —7 — -6 — 7,5 — 7,5 — 10 — — 12 0 10 0—36 0 10 0 -18 0 -18 0 -10 0-36 0 15 35 15 —22 12 —20 30 25 13 20 12 10 7 -10 10 10 0— 7,5 — 12 0 -11 — 12 0 12 ...

378
405
1

di sản phương pháp luận của F.A.Hayek về nghiên cứu các hiện tượng xã hội

Ngày tải lên : 11/04/2013, 13:27

... I: An Introduction to Dynamical Systems and Market Mechanisms Cambridge, MA: MIT Press; Arthur, W Brian, Steven N.Durlauf, and David A Lane (eds.) (19 97), Op cit.; Rosser, J Barkley, Jr (19 99) ... Research Programmes,” Lakatos and Alan Musgrave (biên tập), Criticism and the Growth of Knowledge Cambridge: Cambridge University Press, 19 70) Theo quan niệm Lakatos, khoa học tập lý thuyết khoa ... (continuity) xem Caldwell, Bruce (2004), Hayek’s Challenge: An Intellectual Biography of F A Hayek, Chicago: University of Chicago Press; O’Driscoll, G (19 77), Economics as a Coordination Problem:...

23
759
0

Sensor-based navigation of a mobile robot in an indoor environment

Ngày tải lên : 23/10/2013, 15:15

... low a Table Decision table for angular speed (rad/s) Fig 11 Wall-following generalization track H Maaref, C Barret / Robotics and Autonomous Systems 38 (2002) 1 18 11 fully obstacles of various ... modiﬁcation and/or by addition of obstacles (scene called “real”) (Fig 14 ) 4 .1 Planned path following in a real known environment Fig 13 Coordination of behaviors For the planning of a path, the ... sub-goals In order to assure the control Fig 15 Optimal path Fig 16 Path planning in a real environment H Maaref, C Barret / Robotics and Autonomous Systems 38 (2002) 1 18 13 Table Rules of the path...

18
431
0