on being a therapist—and the consequences of this choice

Making Sense of Animation: How do Children Explore Multimedia Instruction? pot

Making Sense of Animation: How do Children Explore Multimedia Instruction? pot

... meteorological markings on a blank map without the aid of animation After completing the prediction task, learners ‘replayed’ a demonstration of how they interrogated the animation while at the same ... purposes of this chapter, animation is defined as “[…] any application which generates a series of frames, so that each frame appears as an alteration of the previous one, and where the sequence of ... to assume that one representational format was sufficient for understanding the explanation Second, the unusual circular shape of the navigation panel may have created an impression of circularity,...

Ngày tải lên: 31/03/2014, 10:20

37 548 0
báo cáo khoa học: " Making sense of health information technology implementation: A qualitative study protocol" ppsx

báo cáo khoa học: " Making sense of health information technology implementation: A qualitative study protocol" ppsx

... developed an a priori set of codes (Additional file 2: Appendix D) Coding reduces the data so that the data remain manageable, facilitating data clustering and laying a foundation for further analysis ... teams plan to take and their anticipated results as well as the teams’ reflections on the actions taken Questions on the observation guide included the following: What information participants ... electronic patient record adoption Information Systems Management 2007, 24:29-42 44 Apker J: Sensemaking of change in the managed care era: A case of hospital-based nurses Journal of Organizational...

Ngày tải lên: 10/08/2014, 10:23

8 438 1
Tài liệu USB in a Nutshell - Making Sense of the USB Standard ppt

Tài liệu USB in a Nutshell - Making Sense of the USB Standard ppt

... size of transferred a zero-length packet IN DATA x ACK STALL NAK OUT DATA x ACK NAK STALL Token Phase Data Phase Handshake Phase The above diagram shows the format of a bulk IN and OUT transaction ... indicate the type of transaction to follow, data packets contain the payload, handshake packets are used for acknowledging data or reporting errors and start of frame packets indicate the start of ... device a control data packet, it issues an OUT token followed by a data packet containing the control data as the payload If any part of the OUT token or data packet is corrupt then the function ignores...

Ngày tải lên: 13/12/2013, 00:15

30 745 0
Making sense of a complex world Accounting for royalty arrangements – issues for media companies pptx

Making sense of a complex world Accounting for royalty arrangements – issues for media companies pptx

... video games or other forms of content, the accounting implications of these transactions are often complex and may vary depending on the substance of the arrangement Royalties are usage-based payments ... royalties than the value of the advance are additional amounts paid to the author These advances are generally not refundable provided a manuscript (of suitable quality) is delivered by the author ... expense – the actual royalty rate being paid at the current sales level or an effective royalty rate estimated across all sales Again, the decision on whether to apply the actual or effective rate...

Ngày tải lên: 29/03/2014, 20:20

30 481 0
what can you do with a major in biology real people, real jobs, real rewards (what can you do with a major in...)

what can you do with a major in biology real people, real jobs, real rewards (what can you do with a major in...)

... other hand, requires significantly more science: 12 additional hours of biology, an additional year of chemistry or geology, a year of physics, and an additional year of math In contrast, another ... college admission applications Admissions professionals repeatedly say that the most important part of a college entrance application is the transcript For some colleges, that one factor will make ... some particular skills in order to succeed as a biology major and, later on, as a professional Of course, practical knowledge of the fundamentals of biology and other technical areas, such as chemistry...

Ngày tải lên: 01/06/2014, 10:54

142 375 0
making sense of online learning a guide for beginners and the truly skeptical

making sense of online learning a guide for beginners and the truly skeptical

... further information may have changed or disappeared between the time this was written and when it is read Library of Congress Cataloging-in-Publication Data Shank, Patti, 1954Making sense of online ... Denver, called me a while back for some advice She was working on an online course to educate patients about pancreatic cancer and was frustrated with the instructional aspects of the animation She ... Evaluating Online Learning 127 What Is Evaluation? What Aspects of Online Instruction Should I Evaluate? What’s the Difference Between Assessment and Evaluation? How Do You Evaluate a Course...

Ngày tải lên: 03/06/2014, 02:04

187 416 0
I usually catch a bus -Talking About What You Do potx

I usually catch a bus -Talking About What You Do potx

... go? Nightclubs? ANNE Not really Occasionally How often you exercise? always How often you watch TV? sometimes STEVE And what you on the weekend? ANNE Sometimes I go shopping How often you go fishing? ... khác: I’m a builder or I build houses ANNE What you do? STEVE I’m a builder I build houses Đôi ta thêm er vào từ để nghề nghiệp: I bake bread I’m a baker I manage a hotel I’m a hotel manager Bạn ... việc bạn: I work in a bank or I work at a bank Vì bạn giáo viên tiếng Anh: What you do? Người trả lời: I work at a school or I work in a school or I teach English or I’m a teacher Bạn nói bạn...

Ngày tải lên: 12/07/2014, 03:20

9 441 0
Wiley Inside Information Making Sense of Marketing Data.pdf

Wiley Inside Information Making Sense of Marketing Data.pdf

... reason and arrive at conclusions based on information Secondly, we ¯ag the importance of understanding how particular genres of marketing data ®t into the wider jigsaw of all the types of data ... Gerald Zaltman, Professor of Business Administration at Harvard University and an authority on the application of information to decision-making, calls the believability check the traditional ... much larger mass of knowledge that lies more deeply in our mind, out of reach of ready verbal expression This has the paradoxical disadvantage that we are not always aware of what we know and can...

Ngày tải lên: 13/08/2012, 15:38

270 1,1K 2
A study of using english songs as a type of supplementary material in teaching listening for first year non major students of english at phuong dong university

A study of using english songs as a type of supplementary material in teaching listening for first year non major students of english at phuong dong university

... Spada, N.,1999) For this sake, songs seem to very well Songs have a great tendency to attract the attention of students that other forms of the mass media lack According to Subramaniyan A Nambiar ... interest one When asked for the reason, they all argued that because they were always curious about the content of the songs, this task is really helpful as it enables them to have a full understanding ... play a song about parents, such as STRAW HAT, FATHER AND SON etc, then organize some discussion about parental love, the generation gap and so on; before Christmas comes, he can play and teach...

Ngày tải lên: 29/01/2014, 10:33

39 1,1K 3
Making sense of japanese grammar

Making sense of japanese grammar

... of a clause or sentence, and a main clause at the end of a sentence In the above, namae and henji-ga nakatta-desu appear on the right side This order is optimal for a postpositional language ... noun the core of a noun phrase And the particle -kedo connects a subordinate clause to a main clause Just as a name tag is attached to a suitcase rather than to its owner, particles are attached ... Grammatical reasons for alternations of particles The person marked with the particle -ni is an active participant in an interaction The person marked with the particle -to is a “reciprocal” participant...

Ngày tải lên: 13/02/2014, 09:45

216 477 5
Tài liệu What to do after a death in England or Wales pptx

Tài liệu What to do after a death in England or Wales pptx

... ask whether or not they agree to donation 12 What to after a death Where the person who died did not indicate their consent (or refusal) to donate their organs and, in the case of an adult, a ... relatives can’t afford to pay for the funeral They may make a claim on the person’s estate to pay for the funeral Where the person has not died in hospital and there is no-one who can take responsibility ... newspaper in the area where the land is situated The London Gazette is published each working day You will have to pay for the advert out of the estate There is a separate edition of the same...

Ngày tải lên: 16/02/2014, 10:20

74 343 0
Tài liệu IN PLAIN ENGLISH: MAKING SENSE OF THE FEDERAL RESERVE pptx

Tài liệu IN PLAIN ENGLISH: MAKING SENSE OF THE FEDERAL RESERVE pptx

... supporters debated the delicate balance between national and regional interests On a national front, the central bank had to be structured to facilitate the exchange of payments among regions and to ... used in analyzing regional and national bank performance, credit demand and other banking topics Figuring out what to make of all this information is the hard part, of course At the Board of Governors, ... one-year terms on a rotating basis The chairman of the FOMC is also the chairman of the Board of Governors The FOMC typically meets eight times a year in Washington, D.C At each meeting, a senior official...

Ngày tải lên: 16/02/2014, 12:20

22 531 0
Tài liệu The Value of the Case Study as a Research Strategy doc

Tài liệu The Value of the Case Study as a Research Strategy doc

... organizational theory rely heavily upon the case study as a form of data collection and even as a type of unstructured analysis: As a form of research, the case study is unparalleled for its ability ... researchers are to be able to repeat a research programme: It is for this reason that researchers like Yin are especially adamant that a case database be created and maintained to \allow repetition and ... information to other situations This is especially true when there are few case of a critical phenomenon, and little delineation of the phenomenon by the use of deviant examples As mentioned at the...

Ngày tải lên: 20/02/2014, 11:20

15 588 0
Báo cáo khoa học: Alternative splicing: regulation of HIV-1 multiplication as a target for therapeutic action docx

Báo cáo khoa học: Alternative splicing: regulation of HIV-1 multiplication as a target for therapeutic action docx

... UUAGGACAUAUAGUUAGCCCUAGG unknown UGGGU CUAGACUAGA CCAGUAGAUCCUAGACUAGA GAAGAAGCGGAGACAGCGACGAAGA AGAUCCAUUCGAUUAG unknown UAGUGAAUAGAGUUAGGCAGGGA GAAGAAGAA UAGAAGAAGAA 4995–5017 [5, 12, 38, 40] 5362–5366 ... binding on the SLS3 loop to a sequence named ESE2 seemed to only have a limited contribution to the activation of site A3 (25% of the overall activation) Therefore, the most important parameter of ... ( kb) RNAs (Fig 1) In the early phase of HIV-1 gene expression, the five 3¢ss (A3 , A4 c, A4 a, A4 b and A5 ) located in a small central part of the viral RNA are used for production of the completely...

Ngày tải lên: 06/03/2014, 09:22

10 434 0
Báo cáo khoa học: Identification of carbonic anhydrase 9 as a contributor to pingyangmycin-induced drug resistance in human tongue cancer cells ppt

Báo cáo khoa học: Identification of carbonic anhydrase 9 as a contributor to pingyangmycin-induced drug resistance in human tongue cancer cells ppt

... AGCTGGTGCAGGAGGAAGTA CCGAGAACCGAACTTACCAA AGGAAGCACCCAGCAATACCA CACCTTGGATGGGTATTCCA CACAGCTCCCATTCATTCCA TCCTCCCTGGAGAAGAGCTA CTCCTGGGACACGATGC CTGCGGTGCTGTTGTGG CACCATCATAAGGGTAAACAT ACAGCAAAAAGGAGGCCAAA ... ACAGCAAAAAGGAGGCCAAA GCCACAATCCAGTCATTCCA GATAAGCTTGTGGAAGTCGCGT TCTCACTGGCCCTAAACTGG CTGATAGGGGTTGGGTGATG GCATTTCCATTTCCCTAAGCAC CAACACAATCCTGAGGCACA TCCCTTTGCCTCCTGTTGTT GTACTTGCGCTCAGGAGGAG 178 246 ... BCRP CA9 BMP2 MT 2A CD237904 AL707095 AK095731 DKK1 BC037851 b-Actin GAAGAAGGGCCAGACGC CCTTCGCTGAGTTCCTGC ACATCAGCGGATACTACAGAG TTTGAATGGGCGAGTGATTG CGGAAACGCCTTAAGTCCAG AATAAGCTTCCGACTCTAGCCGC AGCTGGTGCAGGAGGAAGTA...

Ngày tải lên: 06/03/2014, 22:21

13 563 0
Báo cáo khoa học: The modulation of metal bio-availability as a therapeutic strategy for the treatment of Alzheimer’s disease pptx

Báo cáo khoa học: The modulation of metal bio-availability as a therapeutic strategy for the treatment of Alzheimer’s disease pptx

... regulation of Ab production, and an increase in tau hyperphosphorylation Furthermore, an increase in extracellular metals can catalyse Ab oligomerization and aggregation, and the amyloid plaques ... biometal homeostasis placed central to all of these AD-related neurodegenerative mechanisms, the modulation of metal bio-availability has strong potential in the therapeutic treatment of AD References ... implicated in the phosphorylation of tau [89] Such data indicate that an increase in cellular oxidative stress, be it through the generation of products of oxidative damage or the activation of...

Ngày tải lên: 07/03/2014, 10:20

9 634 0
a study on impacts and effectiveness of abc costing method as a cost effective measurement in coal industry

a study on impacts and effectiveness of abc costing method as a cost effective measurement in coal industry

... based on the advantages of these methods, the affects on the decisions of managers can be obvious As a result, the author of this thesis hopes that the empirical study of advantages and disadvantages ... information especially accounting information This enhances the importance of ABC in the eye of managers From earlier of the century, many researchers declared that organizations can gain lots of ... hypotheses will be designed based on: + The correspondence between ABC and capability of manufacturing companies + Impacts of the capability on the performance of organizations + Impacts of ABC on...

Ngày tải lên: 13/03/2014, 14:19

64 512 0
w