object s class is a subclass of another

... into various regulatory— regulations I mean, I— as a life in— we have a life insurance company It tells us— what we can in terms of BBB or in terms of A and all of that sort of thing So state after ... particular March, April, and May, it 's it 's it 's shown some acceleration So what 's happening in Europe has not had an effect here yet in— in terms of our businesses It 's it 's a dangerous situation, ... (LAUGH) store still has to buy ads in the paper BECKY: Right, there are— are two proposals in congress that have gotten a lotta play One is from senate— is from Congressman Barney Frank who takes...

Ngày tải lên: 28/06/2014, 17:20

Ngày tải lên: 12/12/2013, 20:53

... used on the camera Absolute rock bottom You'll see cameras advertised as LUX or LUX cameras LUX is equal to 19 foot candles LUX is about 37 foot candles I was suspicious, so a number of years ... levels, consumer cameras often use a setup, or black level, of zero IRE, rather than the 7.5 IRE broadcast standard Some cameras that automatically boost the signal in low light situations can also ... incandescent lamps doesn't make objects it strikes appear bluish Television cameras aren't so versatile They must be set up to render color in a way that 's pleasing to the eye They can this only...

Ngày tải lên: 26/01/2014, 04:20

... ˈbaʊt ˈɡræm ə Don’t be afraid of making mistakes Just try to speak doʊnt biː ə ˈfreɪd ʌv ˈmeɪk ɪŋ mɪ ˈsteɪk dʒʌst traɪ tuː spiːk Speak English as much as possible spiːk ˈɪŋ ɡlɪʃ æz mʌtʃ æz ˈp s ... English is difficult and it s hard to memorize new words ðeɪ θɪŋk ˈɪŋ ɡlɪʃ ɪz ˈdɪfɪk əlt ænd ɪts hɑːrd tə ˈmem ə raɪz njuː wɜːdz and grammatical rules In fact, learning English can be a piece of ... əl Successful people spend a lot of time practicing s k ˈses fəl ˈpiːpəl spend ə lɑːt ʌv taɪm ˈprækt s Remember, practice makes perfect ri ˈmembə ˈprækt s meɪk pə ˈfekt Speak English everyday,...

Ngày tải lên: 27/01/2014, 20:11

... United States (n=1286 fathers; 19% Hispanic, 70% African American, and 8% Caucasian) with a comparison sample of married parents (n=473 fathers; 25% Hispanic, 37% African American, and 32% Caucasian) ... psychosocial conditions, and availability of materials resources, access to health services, and so on One area of interest, then, is the roles that fathers play in shaping the social circumstances, ... connectedness, Attachment, Positive peer relations, Supportive social networks Resiliency, Less delinquent behavior, Less substance use, Less stress, Less depression, Self acceptance, Life satisfaction...

Ngày tải lên: 12/02/2014, 11:20

... the present Bristol Post Office premises in Small Street was occupied by Messrs Freeman and Brass and Copper Company As a matter of history, a copy of the abstract of conveyance may, perhaps, be ... Secretaryship and General Managership of Post Office affairs, was as a youth a disciple of his predecessor, and assisted him in the development of the Mail Coach system He was apprenticed to the Post Office ... CHICHESTER AND THE MARQUESS OF SALISBURY, HIS MAJESTY 'S POSTMASTERS-GENERAL PORTSMOUTH AND BRISTOL: Contractors' Number of Names Passengers In Out Miles Time allowed Dispatched from the Post Office,...

Ngày tải lên: 17/02/2014, 02:20

Ngày tải lên: 18/02/2014, 11:20

... Visualization was performed using the SuperSignal West Pico substrate (Pierce) Statistics Data are presented as means ± standard error of the mean Individual means and distributions were compared ... CTCCAAGCAGATGCAGCAGA M225PO.P: CCGTGGTGCTGATGGGCAAGAA M267PO.R: ACCATGATGCGCAAGGCCAT 1584p21.F: GTACAAGGAGCCAGGCCAAG 1629p21.P: TCACAGGACACTGAGCAATGGCTGATC 1691p21.R: GTGCTTTGACACCCACGGTA 22mUbiq.F: ... Giresi PG, Koncarevic A & Kandarian SC (2003) Global analysis of gene expression patterns during disuse atrophy in rat skeletal muscle J Physiol 551, 33–48 Aihara Y, Kurabayashi M, Saito Y, Ohyama...

Ngày tải lên: 07/03/2014, 03:20

... Ceratocystis fimbriata f sp platani, Snodprot1 of Phaeosphaeria nodorum and Sp1 of Leptosphaeria maculans) or human allergens and pathogenesis-related proteins (As-CG of Coccidioides immitis, Aca1 ... TrichoEST database comprises ESTs of several Hypocrea ⁄ Trichoderma species, and the genome database of H jecorina is available, it was impossible to identify Epl1 via peptide mass fingerprinting This ... Trichoderma spp to induce defense responses in a variety of plants, the molecular basis of this mechanism is still unclear and the number of identified elicitors remains low So far, there is only published...

Ngày tải lên: 07/03/2014, 12:20

... EmbR showed distinct ATPase and GTPase activities, with ATP preferred over GTP as a substrate (Fig 2B) No phosphate was released when ADP was used as a substrate, indicating A ATP that EmbR is not ... courses of ATP and GTP hydrolysis by EmbR The release of Pi was measured, using the malachite green method, at various time points The Pi release was assayed when ATP or GTP was used as a substrate ... STPKs If each of the kinases senses its own signal amongst a plethora of environmental cues, as is known for eukaryotic protein kinases, EmbR makes an integrator of the signals (Fig 6) The idea of...

Ngày tải lên: 16/03/2014, 14:20

... rats A 60 kDa band was present in KA-injected striata (Fig 1E); this band was much weaker in CL striata, and was absent in samples from Tris ⁄ HCl-injected rats To demonstrate the specificity of ... necrosis and apoptosis as defined by classical morphological and molecular criteria [17] It was also shown that excitotoxicity activates cell death programs that result in atypical neuronal cell ... with a Zeiss Axioskop Statistical analyses were perfofmed by ANOVA with Tukey s post hoc test Immunohistochemistry and in situ hybridization For immunohistochemistry and in situ hybridization, rats...

Ngày tải lên: 22/03/2014, 17:20

... DATABASE This is a small sample aimed at illustrating the key features of our Trend Database (just one part of our 2013 Premium Service) Featuring all our trends (theory, stats, opportunities ... DATABASE » STATS CENTER M SA E PL Stats tagged by trends, industry and keyword w w w.t r en d w a t chin g c om | TREND DATABA SE SA MPLE trend watching com PREMIUM 12 MONTHLY SNAPSHOT This is ... DATABASE » TREND DATABASE M SA E PL Keyword search the Database Filter trend examples by industry by trends, industries & time Full list of Trends Full list of Industries w w w.t r en d w a t...

Ngày tải lên: 23/03/2014, 12:20

Ngày tải lên: 04/06/2014, 12:23

... gains access to the nervous system and establishes latency in ganglionic neurons Viral reactivation from this latent state may result in herpes encephalitis A number of studies have demonstrated ... 5'-aaatgaccccttcatcacca-3'; Dsip1: 5'-ggtggccctagacaacaaga-3' and 5'-tcaagcagctcacgaatctg-3'; CIDE-B: 5' ctggaactcagctcctccac-3' and 5'- cctccaggaccagtgttagc-3'; caspase-2: 5'- cagctccaagaggtttttcg-3' and 5'- acatccaggggattgtgtgt-3'; ... Caspase-8-associated protein Fas ligand Caspase-3 Tumor necrosis factor Casp-8 and FADD-like apoptosis regulator TNF superfamily member BCL2-associated athanogene Bcl-associated death promoter Thymoma...

Ngày tải lên: 19/06/2014, 22:20

... yourself Spend money on targeted advertising instead of mass media advertising Personalise all your email messages so that they all get read Using the person s name is essential Follow up regularly ... potential customers why you are having a sale eg clearance sale, end of season sale etc Solve your customer s complaints by being quick and friendly Always make sure everyone is happy with your service ... with all your clients and potential clients Learn sales ideas from reading and studying other business advertising and marketing material Educate yourself with new strategies Form a strategic business...

Ngày tải lên: 28/06/2014, 12:20

... sentence is a single clause, it is called a simple sentence (and the clause is called an independent clause) A sentence must contain at least one independent clause  Below are the four types of sentence ... ends with an exclamation mark For example:  What a beautiful girl !  He is going to win ! The Four Sentence Structures  A sentence can consist of a single clause or several clauses When a sentence ... Sentence A declarative sentence  A declarative sentences make statements or assertions For example:  I shall arrive at there  We must not forget that date 2.An imperative sentence  An imperative...

Ngày tải lên: 13/07/2014, 23:26

... Types of clause Main clause (independent clause) These can stand alone because they express complete thoughts Subordinate clause (dependent clause) These can’t stand alone and need another clause ... WHAT IS CLAUSE?  A c laus e is a group of words that contains a subject and a finite verb Ex: I get slimmer and slimmer S  A c laus e V constitutes only part of a sentence Ex: since I ... noun, adjective, and adverb gfgghgnggggggggdis ghxhgxsjhajhabBDJ HSGDJHGDJHSDJH VXHDVHSVDHAVVS XHS Subordinate clause There are kinds of subordinate clause: noun, adjective, and adverb - An adjective...

Ngày tải lên: 13/07/2014, 23:27

... biological facts, which are almost always beyond the reach of most people 's intuition, seem to indicate that an even more complex system operates in mammals (or at least mice, from which it is probably ... ex-physicists played a crucial part, and who are alleged to have referred to their nearby colleagues at Woods Hole as biologists 'who don't count' In any event, if mathematics must be applied to make ... diminishes his monumental achievement So ostensibly significant a difference between vertebrates in so fundamental a process seems surprising, and may dwindle (either in extent or in significance)...

Ngày tải lên: 06/08/2014, 19:20

Ngày tải lên: 07/08/2014, 03:22

... journal of combinatorics 17 (2010), #R34 Recall that the algebra Sym of noncommutative symmetric functions is the free associative algebra, on the symbol set Sn , whose basis is given by S I = Si1 ... bi-statistics (f, majcode), (f, scode), counter-examples appear at n = Main Lemmas For a coding word α = α1 αn ∈ En , we say that i is a right-maximal index and αi is a right-maximal value of ... permutations and derivation therefrom of functions of a single variable associated with the permutations of any assemblage of objects, Amer J Math., 35(1913), 281-322 [11] P A MacMahon, Two applictions...

Ngày tải lên: 08/08/2014, 12:22