not as enticing as a bestseller reading comprehension

Reading Theory as a Microcosm of the Four Skills

Reading Theory as a Microcosm of the Four Skills

Ngày tải lên : 06/09/2013, 10:10
... constraints, at many different levels, on each occasion that they are called upon, they encourage a unique emphasis on particular combinations of strategies on each occasion In reading, the notions ... is in their emphasis It is my belief that in giving the L2 student both as much input and practice as they can reasonably manage, and a strong metalinguistic awareness, we, as teachers give the ... of reading University systems in Europe, unfortunately, are dominated by the grammar-translation method of language teaching, where, as often as not, English is only taught as a means to accessing...
  • 5
  • 680
  • 0
Tài liệu Information as a product: not goods, not services ppt

Tài liệu Information as a product: not goods, not services ppt

Ngày tải lên : 19/02/2014, 03:20
... remains to be used again and again This is not to say that information always retains its original value, as some types of information, such as news, have an element of timeliness or immediacy Although ... may exist in several modes and be delivered by several media For example, popular books are sometimes sold as hardbacks, paperbacks, audiotapes, and even CDROMs Traditional product classification ... appropriate to model the demand for many goods and services in such a way that, as price approaches zero, demand Jon Freiden, Ronald Goldsmith, Scott Takacs and Charles Hofacker Information as...
  • 11
  • 424
  • 0
Báo cáo khoa học: "Lexical surprisal as a general predictor of reading time" potx

Báo cáo khoa học: "Lexical surprisal as a general predictor of reading time" potx

Ngày tải lên : 08/03/2014, 21:20
... Brian Roark, Asaf Bachrach, Carlos Cardenas, and Christophe Pallier 2009 Deriving lexical and syntactic expectation-based measures for psycholinguistic modeling via incremental top-down parsing ... S4 classes Available from: http://CRAN.Rproject.org/package=lme4 (R package version 0.999375-39) Yoshua Bengio, R´ jean Ducharme, Pascal Vincent, e and Christian Jauvin 2003 A neural probabilistic ... probabilistic language model Journal of Machine Learning Research, 3:1137–1155 Marisa Ferrara Boston, John Hale, Reinhold Kliegl, Umesh Patil, and Shravan Vasishth 2008 Parsing costs as predictors of reading...
  • 11
  • 605
  • 0
Báo cáo khoa học: Coenzyme A affects firefly luciferase luminescence because it acts as a substrate and not as an allosteric effector pot

Báo cáo khoa học: Coenzyme A affects firefly luciferase luminescence because it acts as a substrate and not as an allosteric effector pot

Ngày tải lên : 16/03/2014, 23:20
... preincubating it with ATP, acetate, MgCl2, acetyl-CoA synthetase and inorganic pyrophosphatase (PPase) Then, we conrmed that treated acetyl-CoA was no longer antagonist of L-AMP in bioluminescent reactions ... similarity between rey luciferase and acyl-CoA synthetases, our achievement is not as strange as it seems to be and supports the theory that nowadays rey luciferase evolved from an ancestral acyl-CoA ... H, Kawarabayasi Y, Kondo J, Abe T, Nishikawa K, Kimura S, Hashimoto T & Yamamoto T (1990) Structure and regulation of rat long-chain acylCoA synthetase J Biol Chem 265, 86818685 Goto T, Kubota...
  • 11
  • 475
  • 0
Báo cáo khoa học: Lack of stabilized microtubules as a result of the absence of major maps in CAD cells does not preclude neurite formation pot

Báo cáo khoa học: Lack of stabilized microtubules as a result of the absence of major maps in CAD cells does not preclude neurite formation pot

Ngày tải lên : 23/03/2014, 05:22
... GTTGGTCTCGTCGCTCATCACATCACGAGG GCTTGAAGGCGCTGGATCTGCGACAATAG GACTGGGCTTTCATCAGCGACAGGTGGC GTGAACCACCAAAATCGGAGAACGAAGC CAGGTTCTCAGTAGAGCCAATCTTCGACCTGAC AGAGTCGGATGCAGTTGCCCGGGCAACA GGCTCCTCCAGCACCCTCCGGGTCCCG ... GGCTCCTCCAGCACCCTCCGGGTCCCG CCCCAAACTTGTGACCATCATTC GGAGAAATCATCTTGAGCATAGCG CGAACTCTCAAGGGC ATGCATCAGAACCATGCACG AGCCCTACAATTCCATCCTCACC GCTGAAGGAGACGATGAGGGTGA 82898–82923 83581–83552 91489–91517 ... no MAP band was observed (not shown) Gene and mRNA analyses of MAP1b, MAP2, Tau, and STOP The finding that apparently normal neurites are formed even when CAD cells lack MAP1b, MAP2, Tau, and...
  • 14
  • 416
  • 0
The phrase  Phrase as a group of words, which makes sence, but not complete sense,

The phrase Phrase as a group of words, which makes sence, but not complete sense,

Ngày tải lên : 13/07/2014, 23:26
... old man disease Many case of infectious A story as old as time The Phrase A noun phrase: A noun phrase consits of a noun and all it modifies Ex: The senile old man Many case of infectious disease ... phrase Adjective pharse Verb phrase Adverb phrase Preposition pharse The Phrase There are five commonly occurring types of phrase in English: A noun phrase: A noun phrase consits of a noun and all ... The Phrase What is a Phrase? Phrase as a group of words, which makes sence, but not complete sense, it called a Phrase It is a group of related words without a subject and a verb Word/group...
  • 9
  • 512
  • 0
Báo cáo toán học: "The number of graphs not containing K3,3 as a minor" pptx

Báo cáo toán học: "The number of graphs not containing K3,3 as a minor" pptx

Ngày tải lên : 07/08/2014, 21:20
... classes can be obtained by considering (maximal) planar graphs Due to Kuratowski’s theorem [10] planar graphs are K3,3 - and K5 -minorfree Hence, the class of (maximal) planar graphs is contained ... version available at http://algo.inria.fr/flajolet/Publications [7] O Gim´nez and M Noy The number of planar graphs and properties of random e planar graphs J Amer Math Soc (to appear), arXiv:math/0512435v1 ... planar graphs has attracted considerable attention [1, 7, 2, 3] in recent years Gim´nez and Noy e [7] obtained precise asymptotic estimates for the number of planar graphs Already in 1962, the asymptotic...
  • 20
  • 248
  • 0
Báo cáo y học: "Too cold may not be so cool: spontaneous hypothermia as a marker of poor " ppt

Báo cáo y học: "Too cold may not be so cool: spontaneous hypothermia as a marker of poor " ppt

Ngày tải lên : 13/08/2014, 21:21
... 13 Abbreviations APACHE, Acute Physiology and Chronic Health Evaluation; CA, cardiac arrest; SOFA, Sequential Organ Failure Assessment; TH, therapeutic hypothermia Competing interests The authors ... hypothermia and cardiac arrest, mechanical chest compressions as a bridge to final treatment: a case report Scand J Trauma Resusc Emerg Med 2009, 17:7 Lyon RM, Richardson SE, Hay AW, Andrews PJ, ... Int J Cardiol 2009, 133:223-228 ECC Committee, Subcommittees and Task Forces of the American Heart Association: 2005 American Heart Association Guidelines for Cardiopulmonary Resuscitation and Emergency...
  • 2
  • 170
  • 0
Translation as an enabling strategy for students' reading comprehension of it texts = Sử dụng dịch thuật như một chiến lược trong việc dạy đọc hiểu các bài khoá

Translation as an enabling strategy for students' reading comprehension of it texts = Sử dụng dịch thuật như một chiến lược trong việc dạy đọc hiểu các bài khoá

Ngày tải lên : 30/03/2015, 14:31
... language learning The teacher - the researcher had asked her students to translate their specialist reading into Vietnamese as a compulsory task in class as well as a homework assignment She asked ... reading ability, the fairly good and quite bad reading ability Their reading ability may be affected their attitudes to reading comprehension tasks as well as translation as post -reading activities ... summarize, and react to a reading material through discussions in small or large groups After having read a professional passage as a homework assignment or class task, students were encouraged...
  • 53
  • 595
  • 0
Lab Linux phan I, II Installing Linux as a Server

Lab Linux phan I, II Installing Linux as a Server

Ngày tải lên : 13/09/2012, 10:21
... packages có tên samba rpm –qa samba* => liệt kê packages có tên bắt đầu samba rpm –qa | grep samba => liệt kê packages có tên ch a samba rpm –qd samba => liệt kê files tài liệu liên quan đến samba ... a Cao, Q.1, TP.HCM Tel: (84-8) 38244041 – 0989012418 www.athena.edu.vn - Bạn liệt kê danh sách packages cài đặt (Installed packages) danh sách packages dùng cho bạn download (Available packages) ... (configuration) liệt kê tập tin cấu hình package 3/ Gở bỏ package (Erase): Chú ý: Nếu gỡ bỏ package mà package phụ thuộc vào package khác gỡ bỏ ta dùng thêm tuỳ chọn nodeps  Lỗi package samba-3.0.23c-2.rpm...
  • 99
  • 1K
  • 6
Báo cáo y học: " Self-reported sickness absence as a risk marker of future disability pension. Prospective findings from the DWECS/DREAM study 1990-2004"

Báo cáo y học: " Self-reported sickness absence as a risk marker of future disability pension. Prospective findings from the DWECS/DREAM study 1990-2004"

Ngày tải lên : 26/10/2012, 10:03
... Cochran-Armitage trend test was performed in order to test if a gradual increase in sickness absence was associated with increase in risk of disability pension The SAS procedure PROC GENMOD (SAS ... than days of absence per annum decreased from 2.77 to 2.68, and remained significant There was an increased risk of disability pension for people who were smokers at baseline, whereas there was ... was stronger among men (OR=3.13) than among women (OR=2.19) (Table 2) Additional analysis treating days of sickness absence during 1990 as a continuous variable showed a clear trend of increase...
  • 6
  • 578
  • 0
Báo cáo y học: "An Avian Connection as a Catalyst to the 1918-1919 Influenza Pandemic"

Báo cáo y học: "An Avian Connection as a Catalyst to the 1918-1919 Influenza Pandemic"

Ngày tải lên : 02/11/2012, 11:12
... mammalian hosts These animals, usually pigs, act as a transformer or converters; creating a strain that can more readily infect humans Pigs can be infected with both avian and human influenza A ... outbreak was not even noted in the index in the 1918 volumes of the Journals of the American Medical Association Influenza was not a reportable disease: the only evidence of the early occurrence was ... as a protease to cleave HA which creates a systemic infection as well [1] Taubenberger [1] reported that this transformation was not observed in the1918 strain, or in strains “captured” in nature...
  • 4
  • 520
  • 0
Life as a Ghost

Life as a Ghost

Ngày tải lên : 07/11/2012, 09:08
... straight away without stopping at a petrol station After having talked and talked and talked, and when I finally managed to dismiss her with fake half-promises and sat back into my car at last ... I knew it wasn’t so A more ominous explanation came to my mind Maybe everything was real, and it was taken for granted that I was dead, just I wasn’t! My brain was still working, and I would ... body Admiration and even something like awe Was he awed because she was dead, by the mystery of death? No, he was awed because in his eyes she was beautiful, a beautiful young woman… For a split...
  • 11
  • 452
  • 0
Vcd as a stimulating factor to increase the young learners’ time-on-task

Vcd as a stimulating factor to increase the young learners’ time-on-task

Ngày tải lên : 07/11/2012, 14:44
... language functions and language notions are taught to learners at the same time with the assumption that language learning relates to learning formulaic expressions of language as well as learning ... 2005), he also makes a distinction between task-based teaching and tasksupported teaching The task-based teaching occurs when the teaching is based exclusively on meaning-focus tasks, and the task-supported ... better than audiocassettes (55% vs 32%) In general, with VCDs pupils time-on-task was around 70% of the class-time against 45% of the class-time in case of audiocassettes used Languages are not fixed...
  • 45
  • 516
  • 0
Reading Comprehension Success in 20 mins a day

Reading Comprehension Success in 20 mins a day

Ngày tải lên : 18/03/2013, 01:45
... the main idea of a passage; it must be general enough to encompass all the ideas in that passage, and it usually makes an assertion about the subject of that passage Knowing all that, you can answer ... chimney was reared outside, and the fireplace was as long as my father was tall There was a crane in it, and a bake kettle; and over it great buckhorns held my father’s rifle when it was not in use ... passage (who or what the passage is about) The main idea must say something about this subject The main idea of a text is usually an assertion about the subject An assertion is a statement that...
  • 206
  • 1.1K
  • 25
Flavor enhancement as a tool for increasing pleasantness and intakeof a snack product among the elderly

Flavor enhancement as a tool for increasing pleasantness and intakeof a snack product among the elderly

Ngày tải lên : 03/04/2013, 21:06
... pleasantness ratings, the aroma concentration had a similar effect on both age groups in the first tasting session: the heightened aroma sample was rated as less pleasant than the regular aroma sample ... Preliminary data analysis revealed no significant main effects and only one significant interaction of day and aroma on the pleasantness ratings of the young, implicating an increase in pleasantness ... a small food reward after the last evaluation session Samples The sample material was a fermented oat bran product (Yosaw, Bioferme, Finland), which is a cereal-based snack food similar to flavored...
  • 10
  • 599
  • 1
Stability and in vivo evaluation of pullulan acetate as a drug nanocarrier

Stability and in vivo evaluation of pullulan acetate as a drug nanocarrier

Ngày tải lên : 23/04/2013, 21:38
... BA R = B B A where AUC is the area under the curve Statistical analysis All data are presented as a mean value with its standard deviation indicated (mean ± SD) Statistical analysis was conducted ... (Mw = 200,000) was purchased from Hayashibara (Tokyo, Japan) Epirubicin·HCl (EPI·HCl) was purchased from Hisun Pharmaceutical Co (Zhejiang, China) Poly (vinyl alcohol) (PVA) with an average molecular weight ... main pharmacokinetic parameters were calculated by DAS 1.0 (Anhui, China) program Bioavailability (BA) is a measurement of the rate and extent of a therapeutically active drug that reaches the...
  • 7
  • 391
  • 0
grey water reuse as a sustainable alternative resouree

grey water reuse as a sustainable alternative resouree

Ngày tải lên : 25/04/2013, 08:20
... Piping and Conveyance, Surge/Balancing Tanks, Filters, Pump and delivery piping system A separate sanitary plumbing system has to be installed to separate the grey water from the wastewater discharges ... irrigation and also landscaping Mature Cotton plants Photo: Texas A& M University Young Tomato Plants Photo: Texas A & M University The Water Environment Research Foundation, USA carried out a study ... Grey Water Reuse As A Sustainable Alternative Water Resource The laundry greywater is more contaminated with faecal pathogens from soiled clothing than the bathroom source, though laundry water...
  • 7
  • 369
  • 0
TChon 16 ADJECTIVESLIKE, (NOT) AS…AS, THE SAME AS, DIFFERENT FROM.doc

TChon 16 ADJECTIVESLIKE, (NOT) AS…AS, THE SAME AS, DIFFERENT FROM.doc

Ngày tải lên : 08/07/2013, 01:27
... They always help their mother ………………………………… ….the house work (do –to - doing – done) I………………………………… ….very happy on my last vacation ( am –is – was – were) Ba’s brother ………………………………… ….volleyball ... the market when you were a kid? What did you use to last summer? Are you used to cooking at home? What are you used to doing on Sunday ... Those apples/ delicious/ these apples Ms Hoa / attractive / Mr Lan This pen / good / that pen VII Choose and underline the best answers:...
  • 2
  • 16.3K
  • 392

Xem thêm