nhac beat rhythm of the rain
Báo cáo khoa học: Cloning and expression of the first nonmammalian interleukin-11 gene in rainbow trout Oncorhynchus mykiss pdf
... transcript, of 2 kb, is produced [29]. The trout IL-11 gene gives rise to a single transcript of 3.2 kb in RTS cells, as seen in the northern blot (Fig. 7), and is the largest of the known IL-11 ... differ- ences were a 26 bp insertion in the 5¢-UTR of the cDNA and an insertion of 12 repeats with a consensus of CCAATGATGATCCAAGAAATCCACACTACAG (31 bp) in the 3¢-UTR of the cDNA sequence (Fig. 1). A ... in the 5¢-UTR, and four potential poly(A) signals were found in the 3¢-UTR (Fig. 1), two of them just 14 or 23 bp upstream of the poly(A) tail. The remaining two poly(A) signals were upstream of the...
Ngày tải lên: 07/03/2014, 16:20
impacts of the acid rain program on coal industry employment pdf
Ngày tải lên: 09/03/2014, 18:20
impacts of the acid rain program on coal industry employment docx
Ngày tải lên: 09/03/2014, 22:20
TECHNICAL PAPER NO. 40 RAINFALL FREQUENCY ATLAS OF THE UNITED STATES pot
... the high values. The other uses the annual series which consists only of the highest value for each year. The highest value of record, of course, is the top value of each series, but ... the hydrologic network data. The results of this work showed the importance of the additional data in defining the short-duration rainfall frequency regime in the moun- tainous regions of ... by-product of previous work performed for the Corps of Engineers, was the first paper published under the sponsorship of the Soil Conservation Service. This paper contains a series of rainfall...
Ngày tải lên: 16/03/2014, 11:20
ASSESSMENT OF THE BENEFITS OF EXTENDING THE TROPICAL RAINFALL MEASURING MISSION A PERSPECTIVE FROM THE RESEARCH AND OPERATIONS COMMUNITIES doc
... are drawn from the councils of the National Academy of Sciences, the National Academy of Engineering, and the Insti- tute of Medicine. The members of the committee responsible for the report were ... extend the lifetime of TRMM beyond the original anticipated maximum length of the mission thereby enhancing the value of the data from TRMM to science and operations. The committee found the following: • ... some mirror-image, and the precipitation in a column at least 18 km above the surface. (A margin is needed because of the oblateness of the Earth and the slight eccentricity of the orbit and also...
Ngày tải lên: 22/03/2014, 23:20
The Rainbow Theory: At The End of Social Media
... than saying what we know” So what’s @ the end of social media ?
Ngày tải lên: 11/07/2014, 12:05
Báo cáo lâm nghiệp: "The successional status of tropical rainforest tree species is associated with differences in leaf carbon isotope discrimination and functional traits" pot
... and the y-intercept of the theoretical line (–0.095 and 27.00, re- spectively) fell in the confidence interval (95%) of the slope (−0.084 ± 0.024) and the y-intercept (26.87 ± 1.56) of the re- lationship ... standard error of the species mean. The grey lines represent the upper and lower confidence interval limits (95%) of the relation- ship between ∆ and WUE. The Symbols correspond to the succes- sional ... ∆ and WUE. There was a strong positive and linear relationship between ∆ of sunlit leaves of dominant canopy trees and the leaves of potted seedlings of the same species grown in the glasshouse (P...
Ngày tải lên: 07/08/2014, 16:20
Báo cáo khoa học: "Nutrient efficiency and resorption in Quercus pyrenaica oak coppices under different rainfall regimes of the Sierra de Gata mountains (central western Spain)" pps
... biomass production per unit of absorbed nutrient is simply the inverse of the concentra- tion of the nutrient in question in the tissues of the plant. However, in long-lived ... [38], increasing the NUE. Resorption is the repeated use of the same nutrient units and could therefore be a good means of estimating the efficiency of nutrient use; nevertheless resorption ... therefore, the nature of the underlying sub- strate does seem to have some effect on the P resorption. Furthermore, it is necessary to take the general abun- dance of...
Ngày tải lên: 08/08/2014, 14:21
Báo cáo y học: "Daily rhythm of circulating fat soluble vitamin concentration (A, D, E and K) in the horse" pdf
Ngày tải lên: 10/08/2014, 09:20
Báo cáo y học: "Determinants of the daily rhythm of blood fluidity" doc
Ngày tải lên: 10/08/2014, 09:20
