neurofilament protein is a marker of neuronal vulnerability in ad

... GGCTTCCATGGCATACTCCA 616mCARP.F: CTTGAATCCACAGCCATCCA 641mCARP.P: CATGTCGTGGAGGAAACGCAGATGTC 706mCARP.R: TGGCACTGATTTTGGCTCCT 83E2_14.F: GGGATTTCAAGCGATTGCAA 129E2_14.P: CGCCCCATCTGAAAACAACATCATGC ... GTACAAGGAGCCAGGCCAAG 1629p21.P: TCACAGGACACTGAGCAATGGCTGATC 1691p21.R: GTGCTTTGACACCCACGGTA 22mUbiq.F: TCGGCGGTCTTTCTGTGAG 51mUbiq.P: TGTTTCGACGCGCTGGGCG 96mUbiq.R: GTTAACAAATGTGATGAAAGCACAAA ... CARP, a cardiac ankyrin repeat protein, is downstream in the Nkx2-5 homeobox gene pathway Development 124, 793–804 Kanai H, Tanaka T, Aihara Y, Takeda S, Kawabata M, Miyazono K, Nagai R & Kurabayashi...

Ngày tải lên: 07/03/2014, 03:20

... glycosylation of haemoglobin (glycation) has been shown to increase in the course of mismanaged hyperglycaemia in diabetes [27] Haemoglobin is a useful protein marker of this kind of damage, although ... number of abnormal aspartate residues, spontaneously arising from L-asparaginyl deamidation and/or L-aspartyl isomerization reactions [7] In addition it has been reported that isoaspartate residues, ... 2-mm fractions and the incorporated radioactivity was determined after elution of proteins from each slice [6,9] Radioactivity was expressed as d.p.m./band area Determination of AdoMet and S-adenosylhomocysteine...

Ngày tải lên: 08/03/2014, 22:20

... there was a large number of patients with low bacterial loads In fact, Hill et al [8] have demonstrated that markers of inflammation increased progressively with increasing bacterial load in patients ... study, participated in the analysis and interpretation of data and wrote the manuscript EM, JM and AT designed the study, and participated in the analysis and interpretation of data AM and SV ... speculate that change in bacterial load was unlikely to be a major primary mechanism of exacerbation induction in COPD [27,28] This hypothesis is a matter of debate, because the interpretation of...

Ngày tải lên: 12/08/2014, 11:21

... N, Awaya Y, Oyama T, Yamakido M, Akiyama M, Inoue Y, Yokoyama A, Hamada H, Fujioka S, Hiwada K: KL-6, a mucin-like glycoprotein, in bronchoalveolar lavage fluid from patients with interstitial ... was measured by ELISA (Eisai Corporation, Tokyo, Japan) according to the manufacturer's instructions in BALF and in plasma The intra-assay coefficient of variation was 5.1% and the inter-assay ... Nishimura K, Hiwada K, Kohno N: Comparative study of KL-6, surfactant protein- A, surfactant protein- D, and monocyte chemoattractant protein- 1 as serum markers for interstitial lung diseases Am...

Ngày tải lên: 13/08/2014, 10:20

... black and mean age was 57 years The majority of patients (79%) had HTN and 27% had DM CVD was prevalent in 35% of patients A total of 62% were on angiotensin converting enzyme inhibitors (ACE-i), ... albumin and cardiovascular mortality has been reported by several studies Owen et al (33) demonstrated that hypoalbuminemia was a strong predictor of mortality in dialysis patients Kalantar-Zadeh ... potential scavenger of free radicals Decrease in serum albumin level would lead to decrease antioxidant capacity and favor the noxious effects of oxidative stress on a variety of tissues, including...

Ngày tải lên: 03/11/2012, 11:52

... bronchoalveolar lavage and EB as part of their clinical assessment in order to help confirm the diagnosis of asthma and to exclude any other associated abnormalities such as structural airway abnormalities ... measurements PKJ was involved in biopsy preparation and 19 20 Barbato A, Turato G, Baraldo S, Bazzan E, Calabrese F, Tura M, Zuin R, Beghe B, Maestrelli P, Fabbri LM, Saetta M: Airway inflammation in childhood ... clinical purposes, application of a quantitative score is time consuming Therefore, in order to compare findings to previously published data and to assess whether there is any advantage in using...

Ngày tải lên: 12/08/2014, 16:20

... C-reactive protein as a diagnostic test of sepsis in the critically ill Anaesth Intensive Care 1991, 19:182-186 Povoa P, Almeida E, Moreira P, Fernades A, Mealha R, Aragao A, Sabino H: C-reactive ... amyloid A protein Adv Immunol 1983, 34:141-212 20 Vigushin DM, Pepys MB, Hawkins PN: Metabolic and scintigraphic studies of radioiodinated human C-reactive protein in health and disease J Clin ... identification [7,8,21] Some authors even advocate using CRP as one of the criteria of sepsis [22] Our results showed that CRP is a good marker of bacterial infection in adult atraumatic ED patients...

Ngày tải lên: 12/08/2014, 20:20

... filtration rate in renal transplant recipients Clin Chem 1999, 49:1866-1868 Coll E, Botey A, Alvarez L, Poch E, Quintó LI, Taurina A, Vera M, Piera C, Darnell A: Serum cystatin C as a new marker ... issue are warranted Competing interests The author(s) declare that they have no competing interests References 532 Villa P, Jiménez M, Soriano MC, Manzanares J, Casasnovas P: Serum cystatin C as a ... generally normal free tetraiodothyronine and normal thyroid-stimulating hormone, which confounds extrapolation of published data in this population We feel that future studies to evaluate this issue...

Ngày tải lên: 12/08/2014, 22:21

... substrate) [28] Man does not always die even in critical hypoxic situations, however, implying that a certain amount of adaptation to hypoxia is possible Some of the mechanisms of adaptation to acute ... accumulated during hypoxia The increased protein stability can activate many of the aforementioned mechanisms of adaptation, including the Pasteur effect [40] Table summarizes some of the cellular and ... positive feature, indicating the presence of functioning adaptive metabolic pathways! Increased lactate levels may be considered an early marker of a potentially reversible state, possibly indicating...

Ngày tải lên: 12/08/2014, 23:20

... Liacos C, Katsaragakis S, Konstadoulakis MM, Messaris EG, Papanicolaou M, Georgiadis GG, Menenakos E, Vasiliadi-Chioti A, Androulakis G: Apoptosis in cells of bronchoalveolar lavage: a cellular ... Subarachnoid hemorrhage Subarachnoid hemorrhage Intracerebral hemorrhage Anaphylaxis (anaesthesia) Guillain-Barre syndrome Intracerebral hemorrhage 10 Anaphylaxis (anaesthesia) 11 Epilepsy ARDS, ... = 9) Diagnosis Surgery Head trauma (subdural haematoma) Craniotomy Intracerebral haemorrhage Craniotomy Head trauma (subdural haematoma) Craniotomy Page of 14 (page number not for citation purposes)...

Ngày tải lên: 13/08/2014, 03:20

... immunohistochemistry in brains of rats injected intrastriatally with KA Two days after unilateral injection of KA, BNIP3-immunopositive neurons were present in striatal areas adjacent to the site of ... that the increased expression of BNIP3 after KA BNIP3 in excitotoxicity administration was caused by activation of kainate receptors, brain tissue was processed from rats that received intrastriatal ... functional transmembrane domain protected against glutamateinduced neuronal cell death Thus, BNIP3 activation and expression appear to be both necessary and sufficient for atypical neuronal apoptosis...

Ngày tải lên: 22/03/2014, 17:20

... Leptosphaeria maculans) or human allergens and pathogenesis-related proteins (As-CG of Coccidioides immitis, Aca1 of Antrodia camphorata and Aspf13 of Aspergillus fumigatus) It should be noted that a ... the mascot search engine [49] for a PMF search in several proprietary and public genomic databases using a tailor-made bioinformatics facility The mascot search was run against all proteins and ... Scala A, Pazzagli L, Comparini C, Santini A, Tegli S & Cappugi G (2004) Cerato-platanin, an early-produced protein by Ceratocystis fimbriata f sp platani, elicits phytoalexin synthesis in host and...

Ngày tải lên: 07/03/2014, 12:20

... ethambutol Nat Med 3, 567–570 30 Amemura M, Makino K, Shinagawa H & Nakata A (1990) Cross talk to the phosphate regulon of Escherichia coli by PhoM protein: PhoM is a histidine protein kinase and catalyzes ... phosphorylation of PhoB and PhoM-open reading frame J Bacteriol 172, 6300– 6307 31 Li J, Smith GP & Walker JC (1999) Kinase interaction domain of kinase-associated protein phosphatase, a phosphoprotein-binding ... release of Pi was measured, using the malachite green method, at various time points The Pi release was assayed when ATP or GTP was used as a substrate of EmbR Each time point is the average of...

Ngày tải lên: 16/03/2014, 14:20

... FEBS Y Mukaiyama et al Characterization of bHLH-PAS -A of NPAS2 Table Resonance Raman spectra of the basic helix–loop–helix (bHLH)-PAS -A domain of neuronal PAS domain protein Excitation was at 413.1 ... consisting of 100 mM Tris (pH 7.5) All proteins were His-tag-free Table Optical absorption spectra of isolated basic helix–loop– helix (bHLH)-PAS -A and PAS -A domains of neuronal PAS domain protein ... complicated kinetic behavior Further studies are required to address this issue Based on resonance Raman spectral studies of His119fiAla, His138fiAla, His171fiAla and Cys170fiAla mutants of the isolated...

Ngày tải lên: 30/03/2014, 11:20

... within a scene have the same color temperature A combination of filters and electronic adjustments is used to adapt color cameras to each new lighting situation Most cameras can adjust automatically ... often use a setup, or black level, of zero IRE, rather than the 7.5 IRE broadcast standard Some cameras that automatically boost the signal in low light situations can also be run in manual mode ... an ordinary candle one foot away from a white square on a black background I tested two cameras The first was a popular CCD camera requiring four LUX for minimum illumination The second was a...

Ngày tải lên: 26/01/2014, 04:20

... think English is difficult and it’s hard to memorize new words ðeɪ θɪŋk ˈɪŋ ɡlɪʃ ɪz ˈdɪfɪk əlt ænd ɪts hɑːrd tə ˈmem ə raɪz njuː wɜːdz and grammatical rules In fact, learning English can be a ...   In fact, she is a sales person! “Improve” = cải thiện, cải tiến I want to improve my English! Many people are worried about learning English ˈmen i ˈpiːpl ɑːr ˈwʌrid ə ˈbaʊt ˈlɝːn ... ˈeɪʃ ən doʊnt ˈ wɝːɪ ə ˈbaʊt ˈɡræm ə Don’t be afraid of making mistakes Just try to speak doʊnt biː ə ˈfreɪd ʌv ˈmeɪk ɪŋ mɪ ˈsteɪk dʒʌst traɪ tuː spiːk Speak English as much as possible spiːk ˈɪŋ...

Ngày tải lên: 27/01/2014, 20:11

... 2 TREND DATABASE This is a small sample aimed at illustrating the key features of our Trend Database (just one part of our 2013 Premium Service) Featuring all our trends (theory, stats, opportunities ... campaign On top of that, up to 200 new examples are added each month, and all content can be easily downloaded in various formats, then tailored and presented to your team w w w.t r en d w a ... a t chin g c om | TREND DATABA SE SA MPLE trend watching com PREMIUM 1.1 TREND DATABASE » PREMIUM GATEWAY M SA E PL w w w.t r en d w a t chin g c om | TREND DATABA SE SA MPLE trend watching com...

Ngày tải lên: 23/03/2014, 12:20

... tagged CSB fragments were visualized by antibody Size (in kDa) of molecular mass markers is indicated have for a protein that does not act as a helicase but as a chromatin remodeller? In this ... recombinant CSB protein in fact displays biochemical characteristics that show that the protein functions as a dimer, and that CSB exists as a dimer in solution In addition, we show that endogenous ... homodimerization, we carried out interaction studies of recombinant wildtype CSB [N-terminal hemaglutinin antigen (HA) and C-terminal His6 (HIS) tagged] with CSB fragments (N-terminal S- and HIS- tags and...

Ngày tải lên: 23/03/2014, 15:20

Ngày tải lên: 04/06/2014, 12:23

... used in the study: caspase-3: 5'gggcctgaaataccaagtca-3' and 5'-aaatgaccccttcatcacca-3'; Dsip1: 5'-ggtggccctagacaacaaga-3' and 5'-tcaagcagctcacgaatctg-3'; CIDE-B: 5' ctggaactcagctcctccac-3' and ... BCL2/adenovirus E1B-interacting protein Baculoviral IAP repeat-containing BCL2/adenovirus E1B-interacting protein Apoptosis inhibitor TSC22 domain family Cell-death inducing DNA fragmentation factor ... factor CASP2 and RIPK1 adaptor domain containing protein Fas-associated death domain Fas apoptotic inhibitory molecule Helicase lymphoid specific Interleukin 10 MAP kinase interacting protein C3HC...

Ngày tải lên: 19/06/2014, 22:20