need for advanced municipal wastewater reclamation technologies

... INTRODUCTION 1.1 Need for advanced municipal wastewater reclamation technologies 1.2 Limitations of RO membrane process for wastewater reclamation 1.3 Research needs 10 1.4 ... Application of RO membrane process for wastewater reclamation 20 2.2 Advantages of RO Process for wastewater reclamation 26 2.3 Fouling of RO process for wastewater reclamation 28 2.3.1 Definition ... be needed for the dilution and transport of dirty water before it can be used again (Hinrichsen et al., 1998) Therefore, for developing countries, the demand for incorporating wastewater reclamation...

Ngày tải lên: 12/09/2015, 11:05

... One-Introduction In planning for wastewater reclamation and reuse, one needs to be aware of the health effect of EDCs potentially present in the treated wastewater as conventional wastewater treatment ... ranged from

Ngày tải lên: 14/09/2015, 14:26

... “English words formed by conversion relating to the names of animals” I hope that it will become useful for those who study English vocabulary in general and functions of conversion in word formation ... in word formation relating to names of animals that students need to be familiar with receptively and productively to be able to speak and write in English effectively  To be reference for anyone ... in word formation relating to the names of animals form variety of books and valuable resource such as magazines, the internet, ect Secondly, examples are used to illustrate given information...

Ngày tải lên: 11/12/2013, 23:51

... Miss Nguyen Quynh Hoa from Foreign Language Department for her help and encouragement My sincere thank also goes to Ms Tran Ngoc Lien, Dean of Foreign Language Department for her permission to take ... University Therefore, it was a motivation for the author of the reasons to discuss Hopefully, this study will help students grow awareness of problems that they might have not noticed before and raise ... well as the expectations towards pronunciation Last but not least, all the necessary information needed for the findings of the survey will be collected through the observation and interview...

Ngày tải lên: 17/12/2013, 20:37

... the peptide conformation is largely unchanged [25] The area per lipid headgroup for the control systems (simulation sets OS and NS) remains steady over time at values appropriate for a fully hydrated ... analyzed for the systems simulated in the present study as a function of distance from the peptide There was no substantial difference in the results for the sn-1 and sn-2 chains; hence, for the ... starting point for the study of more complex systems of oligomeric Ab peptides in membrane systems Following NVT equilibration, isothermal–isobaric (NPT) equilibration was performed for 500 ps,...

Ngày tải lên: 18/02/2014, 08:20

... are collected, information from these questionnaires are then summarized and presented in the form of statistic information tables for data analysis to find out the answers for the research questions ... ideas within small group before speaking in public An opinion sharing activity: may require using factual information, formulating arguments and justifying one’s opinion For some topics, there may ... edition published by Oxford University Press are used for four first semesters For the fifth semester, the textbook “International Express” – pre-intermediate published by Oxford University Press...

Ngày tải lên: 28/03/2015, 09:01

... language more time is needed to produce a message It needs revising before being used in formal and official documents It's more standardized and more universal than spoken language For these main reasons, ... what is very unfortunate is that such students are not given any opportunity to learn to understand an informal style of speech, so in addition to teaching the forms of informal and formal English, ... conversations, not formal or literary‟ Colloquial is a familiar style used in speaking and writing Similarly, informal speech means without formality and without strict attention to set forms Likewise,...

Ngày tải lên: 28/03/2015, 09:36

... prepared by the researcher in advance Before reading aloud, they were given several minutes for preparation Scoring is straightforward with points counted only for the individual items being evaluated ... First, before the questionnaire was distributed, the experimental students were made to feel relaxed and comfortable to give their true responses because their own opinions were for study, not for ... question, posed in Section III.2, needs to be satisfactorily answered III.2 Research Questions Based on the aim and objectives of the study, two questions were formulated and needed to be satisfactorily...

Ngày tải lên: 10/04/2015, 18:08

... speaker’s first language The substitution of one consonant for another may cause serious confusion for listeners For instance, by substituting /z/ for /ʤ/, a Vietnamese learner would produce the word ... researcher in advance (see Appendix 1) Before reading aloud, they were given several minutes for preparation Scoring is straightforward with points counted only 35 for the individual items being evaluated ... First, before the questionnaire was distributed, the experimental students were made to feel relaxed and comfortable to give their true responses because their own opinions were for study, not for...

Ngày tải lên: 10/04/2015, 18:08

... prepared by the researcher in advance Before reading aloud, they were given several minutes for preparation Scoring is straightforward with points counted only for the individual items being evaluated ... First, before the questionnaire was distributed, the experimental students were made to feel relaxed and comfortable to give their true responses because their own opinions were for study, not for ... question, posed in Section III.2, needs to be satisfactorily answered III.2 Research Questions Based on the aim and objectives of the study, two questions were formulated and needed to be satisfactorily...

Ngày tải lên: 13/04/2015, 16:43

... (1998), Prefabricated patterns in Advanced EFL writing: collocations and formulae in A P Cowie (ed.), Phraeology, theory, analysis and applications, Clarendon Press, Oxford, pp 145160 Halliday, M (1966), ... Cambridge University Press, Cambridge McIntosh, C et al (2009), Oxford Collocations Dictionary for Students of English OUP, Oxford Moon, R (1997), Vocabulary connections: multi-word items in English ... University Press, Cambridge Nesselhauf, N (2003), “The use of collocations by advanced learners of English and some implications for teaching”, Applied Linguistics, 24(2), pp 223-242 Palmer, H E (1933),...

Ngày tải lên: 10/08/2015, 19:47

... concerned, a good presentation has at least for elements Firstly, it has content which contains information people need, yet, it depends on the amount of information that the audience can absorb at ... assessment the learner is simply informed how well or badly he has performed, in correction, teachers provide some specific information on aspects of the learner’s performance by explaining, suggesting ... 12, 18, 3) It means students will have 42 periods for class meeting, 12 for group discussions and presentations, 18 for self-study and periods for revision with 50 minutes per periods 2.1.2 Subjects...

Ngày tải lên: 25/12/2015, 17:24

... semiquantitative RT-PCR For detection of c-Jun expression, RT-PCR with GAPDH serving as an internal control (in the same PCR reaction) was performed (30 cycles for c-Jun and 30 cycles for GAPDH) Similar ... or vehicle (dimethylsulfoxide) for h and treated with 2.5 lM MG132 or dimethylsulfoxide for an additional 16 h Whole cell lysates were analyzed by western blotting for levels of phosphorylated ... activate apoptosis in many types of cancers, inluding gliomas [8] Hence, much effort has been made to establish new modalities for combined treatments with TRAIL and other antineoplastic agents or apoptosis...

Ngày tải lên: 18/02/2014, 17:20

... electrophoresis, and this was followed by immunoblotting for procaspase-8 and processed forms of the enzyme The positions of the full-length (p53 ⁄ p55) forms of the protein and the p41 ⁄ p43 and p18 cleavage ... indicated The samples were also immunoblotted for a-tubulin as a loading control (C) A similar experiment was performed as in (B) and extracts were immunoblotted for BID The positions of the full-length ... by IFNa and TRAIL Table Requirement for caspase-8 for inhibition of protein synthesis by TRAIL Wild-type and caspase-8-deficient Jurkat cells were incubated for h in the absence or presence of...

Ngày tải lên: 19/02/2014, 06:20

... experiments Cells grown in culture dishes (for Western blot analysis) or on glass cover slips (for immunocytochemistry) to subconfluency were serum-starved for days in order to be arrested in the ... measured for a certain time curve could not be exactly equal to the ÔrealÕ maximum that is reached in the cells The maximal ERK-PP concentration measured for independent curves can therefore differ ... in 5% (w/v) BSA in TBS-Triton (1 : 400) Cells were washed for 15 with TBS-Triton, for 15 with 0.1% (w/v) BSA in TBS-Triton and incubated for h at room temperature with Cy5TM-labeled goat anti-(mouse...

Ngày tải lên: 19/02/2014, 16:20

... preincubated for 15 in 100 lL NaCl ⁄ Pi for complex formation Four hours after transfection, the medium was changed and cells were incubated in normal growth medium for 24 h Luciferase assays were performed ... 1.75 mL 37% formaldehyde, mL formamide) and loading buffer (50% glycerol, mm EDTA, 0.25% Bromophenol blue, water) and separated on a 1% agarose ⁄ formamide gels containing 2.2 m formaldehyde ... sequences: Cox-2 forward, 5¢—CCTTCTCCAACCTCTCCTAC—3¢; Cox-2 reverse, 5¢—AGGGGGTGCCAGTGATAGAG—3¢; PPARb forward, 5¢—AAGAGGAGAAAGAGGAAG TGG—3¢; PPARb reverse, 5¢—ATTGAGGAAGAGGCTG CTGA—3¢; actin forward,...

Ngày tải lên: 07/03/2014, 12:20

... plasma and has the capacity for binding to other metal ions of therapeutic and diagnostic interest [16] Therefore, it has been suggested that Tf can act as a nature ÔcarrierÕ for metallodrugs (e.g ... saturation concentration of Yb2-Tf (0.2 lM vs 0.05 lM for Fe2-Tf) and its competition with iron indicated a lower affinity of cell receptors for Yb2Tf than for Fe2-Tf LCSM offers an effective way to investigate ... and 7.9 lM for apo-Tf and FeC-Tf, respectively) The driving syringes were immersed in a water bath at 298 ± 0.5 K Fourhundred data points were collected over various times (2, and 10 s) for each...

Ngày tải lên: 08/03/2014, 09:20

... incubation at 50–55 °C for 40 followed by 94 °C for min; amplification, 30 to 40 cycles of 96 °C for 30 s, 55 °C to 67 °C (depending on the set of primers used) for 30 s, and 72 °C for 30 s to 1.5 Primers ... desferrioxamines was performed on a reverse-phase column (Nucleosil C18, lm, 4.6 by 150 mm) with 150 lL injection volume and mLÆmin)1 flow rate for 25 A solution of 0.1% aqueous formic acid ⁄ methanol ... responsible for des´ ferrioxamine biosynthesis [13] Barona-Gomez et al [14] proposed a possible pathway for desferrioxamine biosynthesis from l-lysine and reported that desD is essential for desferrioxamine...

Ngày tải lên: 16/03/2014, 11:20

... the carbonyl oxygen atom of NADPO in the former complex [4] This observation prompted us to propose the hypothetical mechanism for the FprA-catalyzed NADPO formation reaction depicted in Fig NADP+ ... resorufin formation On the basis of the quantum yield experimentally determined for resorufin, a rate of 0.08 mol H2O2 (mol FprA))1 was calculated, a value comparable to the rate of NADPO formation ... After centrifugation at 12 000 g for 10 min, the supernatants were dried, resuspended in 50 mm ammonium formate, and chromatographed by a modification of the high-performance ion exchange proce¨ dure...

Ngày tải lên: 16/03/2014, 11:20