... U16-17R gac act cca cca tag atc act c cat gat gca cgc tct acg aga c ctg tga gga act act gtc ttc acg cag cac tcg caa cca ccc tat cag cca gcn cac aaa ggn ata gga gg acb acy gcn cct tch cct ttc ccc aat ... cells are liver macrophages and Hepatocytes are liver endothelial cells 2B-cells priate primer set (Table 2) A band of about 400 bp was seen after PCR analysis, indicating HHV- 6A was replicating in ... of HIV1 and HCV in the same cell may greatly aggravate the malady Our TEM analysis showed HHV- 6A and HCV in the same cells, with extracellular HIV-1 particles budding or adjacent to the infected...
Ngày tải lên: 18/06/2014, 18:20
... U16-17R gac act cca cca tag atc act c cat gat gca cgc tct acg aga c ctg tga gga act act gtc ttc acg cag cac tcg caa cca ccc tat cag cca gcn cac aaa ggn ata gga gg acb acy gcn cct tch cct ttc ccc aat ... cells are liver macrophages and Hepatocytes are liver endothelial cells 2B-cells priate primer set (Table 2) A band of about 400 bp was seen after PCR analysis, indicating HHV- 6A was replicating in ... of HIV1 and HCV in the same cell may greatly aggravate the malady Our TEM analysis showed HHV- 6A and HCV in the same cells, with extracellular HIV-1 particles budding or adjacent to the infected...
Ngày tải lên: 20/06/2014, 01:20
Báo cáo hóa học: " Research Article Fixed Point Methods for the Generalized Stability of Functional Equations in a Single Variable" ppt
... 43–52, Karl-Franzens-Univ Graz, Graz, Austria, 2004 21 L C˘ dariu and V Radu, A Hyers-Ulam-Rassias stability theorem for a quartic functional equation,” a Automation Computers and Applied Mathematics, ... M Rassias, “On approximation of approximately linear mappings by linear mappings,” Journal of Functional Analysis, vol 46, no 1, pp 126–130, 1982 J M Rassias, “Solution of a problem of Ulam,” ... transformations,” Bulletin of the American Mathematical Society, vol 57, pp 223–237, 1951 Z Gajda, “On stability of additive mappings,” International Journal of Mathematics and Mathematical Sciences, vol...
Ngày tải lên: 22/06/2014, 06:20
báo cáo khoa học: "Triple malignancy in a single patient including a cervical carcinoma, a basal cell carcinoma of the skin and a neuroendocrine carcinoma from an unknown primary site: A case report and review of the literature" ppt
... al.: Triple malignancy in a single patient including a cervical carcinoma, a basal cell carcinoma of the skin and a neuroendocrine carcinoma from an unknown primary site: A case report and review ... reported a case of four malignancies in the same patient including a cervical carcinoma and a basal cell carcinoma but in a metachronous setting [6] Human papilloma virus (HPV) infection has a wellestablished ... the analysis of the data HE approved the treatment and analyzed the literature data All authors read and approved the final manuscript Competing interests The authors declare that they have no...
Ngày tải lên: 10/08/2014, 23:20
Báo cáo y học: "The leading causes of death after burn injury in a single pediatric burn cente" docx
... on findings at autopsy, aspiration or asphyxia, or asthma attack ARDS was clinically defined by meeting four criteria: acute onset; bilateral fluffy pulmonary infiltrates by x-ray; pulmonary artery ... pneumonia, and also demonstrated pathological evidence of DAD The one patient that died of an acute asthma attack also had ARDS, but it was the asthma attack that was the fatal event Respiratory ... TBSA burn Inhalation injury was present in 20% of all admitted burns Figure Brain deaths Brain injury accounted for 16% of all deaths Anoxic brain injury accounted for 48% of the brain deaths after...
Ngày tải lên: 13/08/2014, 20:21
Báo cáo khoa học: "The clinical value of daily routine chest radiographs in a mixed medical–surgical intensive care unit is low"
... clinically relevant and irrelevant findings, and simply reported on all abnormalities [12] At present, in many ICUs CXRs are still routinely obtained on a daily basis, at least in The Netherlands ... design and statistical analysis of the study MS conceived and coordinated the study and was involved in the interpretation of the data and manuscript revision All authors read and approved the final ... (0.0%/1.4%)* Total (% of all daily routine chest radiographs in group) Values are expressed as unexpected abnormalities resulting in a change in management (n)/all unexpected abnormalities per category...
Ngày tải lên: 25/10/2012, 10:39
What’s in a Name
... but always in action —M O H A N DA S K A R A M C H A N D G A N D H I , nationalist and reformer (1869–1948) 54 A N O T H E R W O R D A D AY ● “During the course of a year, a wedding and a funeral ... and take a sip Of the Real Old Mountain Dew —Sam Hinton, La Jolla, California He who is cruel to animals becomes hard also in his dealings with men We can judge the heart of a man by his treatment ... royalist sentiments and low crime rate hark back to an era that faded away decades ago in Britain.” —New York Times Bobbies and Peelers It’s interesting to note that the folks in England regarded...
Ngày tải lên: 25/10/2013, 16:20
Tài liệu Retrieving a Single Value from a Query pdf
... compared to retrieving a single value using an output parameter or using a DataReader, it allows a single value to be returned with the least code and may therefore improve readability and maintainability ... ExecuteScalar( ) method of the Command object returns a single value from the data source rather than a table or data stream While the ExecuteScalar( ) method does not result in a performance improvement ... therefore improve readability and maintainability If the result set returns more than one result, the first column of the first row is returned as a scalar value A null reference is returned if the...
Ngày tải lên: 14/12/2013, 18:16
vnode - A Validated Solver for Initial Value Problems in Ordinary Differential Equations
... can be implemented, for example, as a + b = [a + b, a + b], a − b = [a − b, a − b], a × b = [min{ab, ab, ab, ab}, max{ab, ab, ab, ab}], a/ b = [a, a] × [1/b, 1/b], and ∈ b / On a computer, a and ... containing interval libraries I LIBS names of interval libraries MAX ORDER value for the maximum order VNODE-LP can use L LAPACK L BLAS name of the directory containing the LAPACK library name of ... scalar.cc 35 ≡ #include #include "vnode.h" using namespace std; using namespace vnodelp; scalar ODE example 32 int main ( ) { set scalar ODE initial condition and endpoint create scalar...
Ngày tải lên: 12/01/2014, 22:07
Tài liệu Báo cáo khoa học: A single amino acid substitution of Leu130Ile in snake DNases I contributes to the acquisition of thermal stability A clue to the molecular evolutionary mechanism from cold-blooded to warm-blooded vertebrates docx
... generating a thermally stable enzyme form from a thermally unstable one: frog, toad and newt DNases I all have a Ser205 insertion in a domain that contains an essential Ca2+binding site in the mammalian ... obtained from the Japan Snake Institute, Gunma, Japan Phenyl Sepharose CL-4B, DEAE Sepharose CL-6B and Superdex 75 were purchased from Amersham Pharmacia Biotech; Concanavalin A (Con A) agarose ... Yasuda, T., Sawazaki, K., Nadano, D., Takeshita, H., Nakanaga, M & Kishi, K (1993) Human seminal deoxyribonuclease I (DNase I): purification, enzymological and immunological characterization and...
Ngày tải lên: 20/02/2014, 23:20
Comparison of the obstetric anesthesia activity index with total delivery numbers as a single denominator of workload demand in Israeli maternity units doc
... epidural analgesia and cesarean anesthesia (including anesthesia for retained placenta and complicated vaginal deliveries, antenatal or pre-operative consultation, and resident training) In some ... medical graduates to the specialty and dwindling immigration) and an increase in overall workload demand (particularly in obstetric anesthesia) [1] Obstetric anesthesia workload in Israel has increased ... epidural labor analgesia and cesarean delivery The OAAI is a formula composite comprising data taken from the annual numbers of epidurals and cesareans in each institution In this study, these data...
Ngày tải lên: 05/03/2014, 15:20
Báo cáo khoa học: A single EF-hand isolated from STIM1 forms dimer in the absence and presence of Ca2+ ppt
... canonical EF-hand motif and cause conformational changes in this motif The Ca2+ signal change and the accompanying conformational change in the canonical EF-hand are probably relayed to the SAM ... CD2.STIM1.EF increased, indicating that the inserted EF-hand motif at least partially maintains the natural helical structure after grafting The Ca2+ dissociation constant of CD2.STIM1.EF (512 lm) is in ... forms a globular domain to allow for cooperative Ca2+ binding, responding to a narrow range of free Ca2+ concentration change To examine the key determinants for Ca2+ binding and Ca2+-induced...
Ngày tải lên: 07/03/2014, 00:20
Báo cáo khoa học: A single mismatch in the DNA induces enhanced aggregation of MutS Hydrodynamic analyses of the protein-DNA complexes pot
... 5¢-TCACCATAGGCATCAAGGAATCGCGAATCCGCCTCGTTCCGGCTAAGTAACATGGAGCAGGTCGCG ATTTCGACACAATTTATCAGGCGAGCACCAGATTCAGCAATTAAGCTCTAAGCC- 3¢ 5¢-GGCTTAGAGCTTAATTGCTGAATCTGGTGCTCGCCTGATAAATTGTGTCGAAATCCGCGATCTGCTCC ... 5¢-GCCTCGTTCCGGCTAAGTAACATGGAGCAGGTCGCGGATTTCGACACAATTTATCAGGCGA-3¢ 5¢-TCGCCTGATAAATTGTGTCGAAATCCGCGATCTGCTCCATGTTACTTAGCCGGAACGAGGC-3¢ 5¢-TCGCCTGATAAATTGTGTCGAAATCCGCGACCTGCTCCATGTTACTTAGCCGGAACGAGGC-3¢ ... 5¢-GGCTTAGAGCTTAATTGCTGAATCTGGTGCTCGCCTGATAAATTGTGTCGAAATCCGCGATCTGCTCC ATGTTACTTAGCCGGAACGAGGCGGATTCGCGATTCCTTGATGCCTATGGTGA-3¢ 5¢-GGCTTAGAGCTTAATTGCTGAATCTGGTGCTCGCCTGATAAATTGTGTCGAAATCCGCGACCTGCTCC ATGTTACTTAGCCGGAACGAGGCGGATTCGCGATTCCTTGATGCCTATGGTGA-3¢...
Ngày tải lên: 07/03/2014, 12:20
Báo cáo khóa học: A single mutation that causes phosphatidylglycerol deficiency impairs synthesis of photosystem II cores in Chlamydomonas reinhardtii pdf
... TCC TGC CAC TGA CGT CCT ATT TTA ATA CTC C-3¢, and Acod (reverse): 5¢-CGC GGA TCC ATG GAA TCG ATG TAT AAA CGG TTT TCA GTT GAA GT-3¢, and the EcoRI restriction fragment of the chloroplast genome ... separating gel consisted of a 4–13% (w/v) acrylamide gradient whereas the stacking gel was 4% (w/v) acrylamide Final concentrations of Bistris and amino-ncaproic acid in gel buffer were 25 mM and ... thylakoids of the WT strain displayed several green bands (Fig 3; A E) migrating above those containing free antennae The free antenna was recovered in three bands obviously reduced in mf1 and...
Ngày tải lên: 07/03/2014, 15:20
Báo cáo Y học: Restoring enzyme activity in nonfunctional low erucic acid Brassica napus fatty acid elongase 1 by a single amino acid substitution pdf
... oleracea MDE line 103, B rapa MDE line R500 and LEA B napus cv Westar were aligned Amino acid residues at position 282 are shaded in black and indicated by the black arrow The amino acid residues at ... one at position 118 with asparagine instead of aspartic acid, while at the position 484 in Hero, aspartic acid is substituted by a glutamic acid residue HEA B rapa FAE1 has a serine residue at ... LEA B napus cv Westar is at position 282 While all functional elongases have a serine amino acid residue at that position, in the catalytically inactive protein from LEA cv Westar serine 282...
Ngày tải lên: 08/03/2014, 09:20
Expect the Unexpected: Building business value in a changing world pptx
... both geographically and in terms of type of usage: municipal and domestic, agricultural or industrial Agriculture in India, sub-Saharan Africa, and Asia (excluding China) is forecast to create the ... range of industries in 22 countries: Australia, Brazil, Canada, China, Denmark, France, Germany, India, Ireland, Italy, Japan, Mexico, Netherlands, Russia, Singapore, South Africa, South Korea, ... context may generate insights such as: • Demand and supply stresses are likely to be concentrated in areas such as China and India that already experience massive challenges of water availability and...
Ngày tải lên: 15/03/2014, 21:20
Báo cáo Y học: Balanced expression of single subunits in a multisubunit protein, achieved by cell fusion of individual transfectants docx
... were fixed and stained with an anti(human J-chain) Ig to verify the presence of intracellular J-chain A further attempt to directly quantify the amount of intracellular J-chain was avoided, as retention ... demonstrated that a sufficient amount of J-chain was available for SIgA complex formation One SIgA-producing clone (SIgA-3) along with pIgA-D and IgA-29 were analysed by SDS/PAGE gel and Western ... producing pIgA and SC resulted in clones producing SIgA (DAKO; : 3000 dilution) The absorbance was read by TitertekÒ Multiskan (ICN Flow, USA) The amount of IgA present in each supernatant was calculated...
Ngày tải lên: 18/03/2014, 01:20
A Single-Molecule Perspective on the Role of Solvent Hydrogen Bonds in Protein Folding and Chemical Reactions pptx
... unfolding the I27 protein in D2O The pulling coordinate for the separating b-strands is defined as the distance between the first amino acid of strand A (Y9) and the last amino acid of strand ... result of a delicate balance between intramolecular and hydration interactions, D2O may alter the dynamics of protein function in subtle and non-intuitive ways.[32–35] Interestingly, in contrast to ... pulling coordinate for the A and G b-strands as the distance between the first amino acid of strand A (Y9) and the last amino acid of strand G (K87) This distance, x(Y9)ÀxACHTUNGRE(K87), increases...
Ngày tải lên: 22/03/2014, 18:20
Báo cáo khoa học: Dynamin-like protein-dependent formation of Woronin bodies in Saccharomyces cerevisiae upon heterologous expression of a single protein pdf
... USA) Plasmids and cloning procedures For heterologous expression in yeast, N crassa HEX1 was amplified from a N crassa cDNA library using PCR with primer pair RE951 (AAGAATTCATGGGCTACTACGA CGAC) ... strain DH 5a was used (Invitrogen, Carlsbad, CA, USA) The yeast wild-type strain BY4742 was used The strain BY4742pex5D was obtained from the EUROSCARF strain collection (Frankfurt, Germany) and ... data indicated that a typical HEX1 crystal core was formed in yeast which is likely to contain only minor inclusions of peroxisomal matrix proteins A C Vps1p and Dnm1p: two dynamin-like proteins...
Ngày tải lên: 23/03/2014, 07:20
Báo cáo khoa học: Fast set-up of doxycycline-inducible protein expression in human cell lines with a single plasmid based on Epstein– Barr virus replication and the simple tetracycline repressor ppt
... pEBTet is AAGCTT GAATTCTGCAGAT TCGA gccacc ATGCGGGA (polylinker in bold, Kozak motif in lower case, cDNA underlined); the 3¢ interface is ATTTCTAGA TCCAGCAC For pEBTetD ⁄ ETTh, the 5¢ interface is ... eGFP, the 5¢ interface is GGTACCG CGGGCCCGGGATCCATC gccacc ATGG TGA; the 3¢ interface is CAAGTAAA GCGGCCGC For pEBTetD ⁄ eGFP, the 5¢ interface is identical; the 3¢ interface is CAAGTAAA GCGGCCGCGG ... SLC2 2A1 6h, the 5¢ interface is GGTACC CCCCCGGA; the 3¢ interface is ATGCCTGC GGGGATCCAC TAGTAACGGC CGCC AGTGTG CTGGAATTCT GCAGATATCC ATCACAC TGGCGGCC The cDNA of eGFP corresponds to GenBank entry...
Ngày tải lên: 23/03/2014, 09:21