murine growth factor p40 t cell growth factor iii

... Th17 cells T cells develop in the thymus Matured circulating T cells that have not yet encountered their antigens are known as naїve T cells When they encounter antigen, T cells are induced to ... self-tolerance in the CD4+ T cell compartment T cells are influenced by TGF- β at all stages of their development TGFβ inhibits T cells proliferation, cytokine production and cytotoxicity TGF- ... the fact that maturation process of DCs initiating mainly by PAMPs represents a key regulatory step from innate recognition to adaptive T cell activation and T cell effector function In another...

Ngày tải lên: 14/09/2015, 08:27

... AAC CTT; Foxp3-RV, TTC TCA CAA CCA GGC CAC TTG; Foxp3-TP, ATC CTA CCC ACT GCT GGC AAA TGG AGT C; TGF-β-FW, TGA CGT CAC TGG AGT TGT ACG G; TGF-β-RV, GGT TCA TGT CAT GGA TGG TGC; TGFβ-TP, TTC AGC ... condition with Treg cells)/Radioactivity in condition without Treg cells) against the number of Treg cells R404 Arthritis Research & Therapy Vol No Kelchtermans et al Antibody administration ... [3H]TdR and harvested The suppressive activity of the Treg cells can be presented by plotting the percentage of inhibition (100 × (Radioactivity in condition without Treg cells – Radioactivity...

Ngày tải lên: 09/08/2014, 06:22

... used to predict treatment outcomes or further stratify patients with the same IPI scores Castillo et al reported that a PIT score > and lymphopenia were independent prognostic factors for predicting ... performed at the time of diagnosis and prior to treatment No patients showed clinical signs of severe infection at the time of laboratory testing The study protocol was approved by the institutional ... patients with PTCL-NOS treated with anthracycline-containing chemotherapy Patients and methods Patients Patients diagnosed with PTCL between January 2000 and December 2009 from Korean institutions...

Ngày tải lên: 10/08/2014, 21:23

... rhGH treatment promotes the restoration of Tcell responses against HIV-1, a restoration that declines with cessation of treatment Since HIV-1+ patients commonly develop growth hormone abnormalities, ... Figure treated patients at baseline in response 12, 24 in HAART IFN-γ production by T cells and at weeksto PHA and 48 IFN-γ production by T cells in response to PHA in HAART treated patients at baseline ... abnormalities, our data have important implications for the treatment of HIV-1, and raise the possibility that rhGH may form part of an immune-based therapeutic programme tailored to the treatment of HIV-1...

Ngày tải lên: 11/08/2014, 10:23

... anti-CMV CD4pos T- cell response in RA patients treated with anti-TNF-α is of interest Case reports have mentioned the reactivation of CMV in anti-TNF-treated patients [3] It is thus important to ... signed-ranks test Statistical analyses were performed by using Stata Statistical Software (Intercooled Stata 8.2; Stata Corporation, College Station, TX, USA) Results Characteristics of patients Twenty-five ... help to identify risks of viral infection in patients treated with anti-TNF In addition, the conservation of anti-CMV CD4pos T cell immunity during anti-TNF treatment suggests that vaccinations...

Ngày tải lên: 12/08/2014, 14:22

Ngày tải lên: 13/08/2014, 01:20

... directly and without ubiquitination, of some proteins that interact with HBZ [17] Thus, HBZ interacts with host factors and modulates their function, which is likely to contribute to persistent ... without interfering with the suppressive function of ATF3 These results suggest that ATF3 suppresses Taxmediated ATF/CRE-dependent transcription both of cellular genes and the HTLV-1 LTR ATF3 has growth ... ATL patient immunoprecipitation assay detected ATF3 bound to the proximal AP-1 site, but ATF3 bound to ATF site was non-specific (Figure 5E) Transient transfection of Jurkat T cells by electroporation...

Ngày tải lên: 13/08/2014, 01:20

... has a growth promoting activity in T- cells, thus suggesting that this growth promoting activity of Tax2 contributes to HTLV-2-mediated T- cell transformation Since at least two functions, apoptosis ... resistance to CsA in Tax2-transformed CTLL-2 cells In contrast to Tax2, the cell growth of Tax1-transformed cells was little affected by CsA This finding is also consistent with the result that Tax1 ... CsA-mediated growth inhibition These results show that the activation of NFAT by Tax2 stimulates the cell growth of some Tax2-transformed cells, but not Tax1-transformed ones A real-time polymerase...

Ngày tải lên: 13/08/2014, 09:20

... transfection (Figure 3A) These results indicate that Tax∆C still has IL-2-independent growth inducing activity in CTLL-2 cells, but the activity is much less than that of Tax1 Both Tax2B and Tax2B+C ... T- cells We recently showed that Tax2, through the activation of transcription factor NFAT, constitutively induces the expression of IL-2, and the induced IL-2 promotes the cell growth of HTLV-2-infected ... of Rat-1/Tax1 cells were greater than those of Rat1/Tax2B cells, but the presence of Tax1 PBM was only correlated with the number but not the colony size [33] These results suggest that the Tax1...

Ngày tải lên: 13/08/2014, 09:21

... 5'-gatcGACATTTCCCGTCCCGCG-3', Stat5 consensus binding motif (β-casein) derived from β-casein promoter 5'-gatcAGATTTCTAGGAATTCAAATC-3' and βcasein mutant 5'-gatcAGATTTAGTTTAATTCAAATC-3' To identify Stat proteins in the ... Western blot Actin expression served as a loading control Figure T- cell lines Constitutive activation of Stat3 and Stat5 in HTLV-1-infected Constitutive activation of Stat3 and Stat5 in HTLV-1infected ... leukemic cells from HTLV-1 seropositive patients with ATL also displayed constitutive activation of Jak3, Stat1, Stat3 and Stat5 [14] These results suggest that activation of the IL2R signalling pathway...

Ngày tải lên: 13/08/2014, 09:21

... Regulatory T cells (iTreg), Tumor Infiltrating Lymphocytes (TIL), Transforming Growth Factor Beta (TGFβ) COMPETING INTERESTS None AUTHORS’ CONTRIBUTIONS The experiments were carried out by JQ, LM, TD, ... induced in both CD4 and CD8 T cells through engagement of their T cell receptors (TCR) and exposure to transforming growth factor beta (TGFβ) [7-10] These so called “induced” Treg (iTreg), both CD4 ... jeconomou@mednet.ucla.edu ABSTRACT Regulatory T cells (Treg) that express the transcription factor Foxp3 are enriched within a broad range of murine and human solid tumors The ontogeny of these Foxp3 Tregs...

Ngày tải lên: 10/08/2014, 21:23

... and evaluation and to analysis of T- cell proliferation PM contributed to the design of the study and to manuscript preparation All authors contributed to interpretation of the data All authors read ... summarized in Table Thus, overall, the results obtained with MSC treatment for CIA are inconclusive This is in contrast to transfer of Treg cells for the treatment of CIA When mice are injected with × ... reported that intravenous administration of the immortalized MSC cell line C3H1 0T1 /2 to immunized mice had no effect on the development of CIA [26] The treatment protocols and results of these studies...

Ngày tải lên: 12/08/2014, 11:23

... AGTGAGATGGATACAGGTGCTAAAC TCTGGACCTCAGACATGAACTTACT TGTCAGTCCTCTTTAATGCT AATGGTATCCTGTTTGGCTCAG GGTTGTAATTGTACACGGTAGTC CGGTAGTCAGGAAATCAATGCC CCATGTCTGCAGATGGTCGAGG GGACTGACATTGCTCCAGAGC GCTTCAGTGACTCAGAAATTGG ... TGAGTTACACGTTCAGTCAGCAATATG Real-time TCTTGGTCTTTAGTTCTTATCATCTTGAGC Real-time AAGATTCTCAGCTACATAATGCACACC Real-time ATGCTCATCAGTAGATTCTGCTCAC Real-time ACGCTTCTTCTTTGCGACTG Real-time CACCATATCCCGCTTGAGTT Real-time ... GCTTCAGTGACTCAGAAATTGG GTCCAGAATATTCAGCCTTTCACC CTCCCTCAAACAAACCAGAGTC CACTGGATGAGACAGGAAGTT CTTCTCCAGGACAGTCCAAAGAGTC CTGGATTGAAGCGCCCTCGGTTAATC GCTGCCTTTGTTATTTGTAAGCTTCAG GGAAACTTCCTGTCTCATCCAGTG...

Ngày tải lên: 16/02/2014, 09:20

... different concentrations studied These peptides were also tested for their toxicity using the MTT assay [17] All the four peptides tested in the study resulted in 90–100% viability indicating that these ... primary structure of the peptide To confirm our hypothesis that the b-turn structures are important for the inhibitory activities of the peptides, the structures of the cyclic peptides were determined ... indicated that the cyclic peptides acquire b-turn structures in solution Cell viability assays clearly suggested that the peptides are not toxic to cells tested in the studies, and represent potential...

Ngày tải lên: 19/02/2014, 13:20

... indicates that total raft fractions contain two distinctly different subpopulations of membranes with respect to cholesterol enrichment Approximately 40% of total raft protein was recovered in the ... contents recovered in raft fractions depend on detergent concentrations We examined the effect of Triton 5457 Two raft subsets in T- cells Fig Protein partitioning under different detergent conditions ... fraction contained cholesterol at a level more than twofold that of the unbound fraction, a finding consistent with its higher C ⁄ P ratio It is noteworthy that the PS ⁄ PI intensity ratio was remarkably...

Ngày tải lên: 20/02/2014, 03:20

... anti-CD3 stimulation in 3BP2-transfected cells Furthermore, SHP-1 also inhibited the constitutive NFAT activation in 3BP2-transfected cells but not the basal NFAT activity in the cells without ... response to TCR activation We next determined the effects of these 3BP2 mutants on NFAT activation To so, we cotransfected 3BP2 or its mutants with NFAT-luciferase (firefly) reporter into Jurkat cells ... dephospharylate 3BP2 without association of the two proteins through the SH2 domain–phosphotyrosine interaction in the condition with the overexpression of the two proteins To exclude the possibility that...

Ngày tải lên: 07/03/2014, 12:20

... primer, 5¢-GGGTAATTTGAGATC TTTATATGATAACC-3¢ and 3¢ primer, 5¢-CGCGCGG GATCCTTAGTGATGGTGATGGTGATGGGTGACC GGTTTTTTGGTAGGTGAAC-3¢ The third PCR was carried out using PCR products, the first PCR 5¢ primer ... 5¢-CGCGCGGGATCCTTAGTG ATGGTGATGGTGATGGGTGACCGGTTTTTTGG Ó FEBS 2004 Interaction of human TCR with superantigen SSA (Eur J Biochem 271) 4077 TAAGGTGAAC-3¢) that had NcoI and BamHI restriction sites, respectively ... disulfide bond formation Primers used for first PCR were: 5¢ primer, 5¢-CATGCCATGGCCAGTAGTCAGCCTGA CCCTACTCCAG-3¢ and 3¢ primer, 5¢-GGTTATCATA TAAAGATCTCAAATTACCC-3¢, for the second PCR the primers were:...

Ngày tải lên: 07/03/2014, 16:20

... peptide was incubated without the GST-Lck To determine the total radioactivity present for each experiment, 12 lL lots of pooled, stopped reaction mixture were pipetted on to three phosphocellulose ... Consequently, tyrosines located on the peptides may be expected to exhibit the same kinetics as those located on the intact protein Therefore, determination of the kinetics of phosphorylation of these ... occur at a constant rate over the 30 duration of the assay (data not shown) and was not limited by concentrations of peptide or ATP, the latter giving rise to near saturation (95%) of the enzyme...

Ngày tải lên: 08/03/2014, 02:20

... relapse of ATL in postallogeneic stem cell transplantation patients The expression of Tax by the host cell targets them for attack by CTL, resulting in the elimination of the infected cell [32] ... stem cell transplantation patients, which might account for the efficacy of this therapy [31] Therefore, the efficient induction of HTLV-1-specific CTL by OML ⁄ Tax could be adapted to prevent the ... Laboratories) positive rate in the CFSE-positive cells when target cells were cocultured with effector cells T0 = Annexin V positive rate in the CFSE-positive cells when target cells were not cocultured...

Ngày tải lên: 14/03/2014, 23:20

... 5¢-CACCCAAGCTT GCCACCATGGAGGTTCAGCTGCAGCAGTCTG-3¢; primer 7, 5¢-GGT GGAGGAGGTTCTGATGTTTTGATGACCCAAACTCCAC-3¢; primer 8, 5¢-CGAATGCGGCCGCCCGTTTGATTTCCAGCTTGGTGC-3¢; primer 9, 5¢-GGTGGAGGAGGTTCTGATGTTGTTCTGACCCAAACTCCACTC-3¢; ... CCTCCTCACCGGATCCTCCACCTCCAGAACCACCACCCCC-3¢; primer 13, 5¢-CGTCTCCTCAGGGGGTGGTGGTTCTGGAGGTGGAG GATCCGGTGGAGGAGGTTCT-3¢; primer 14, 5¢-CGTCTCCTCA GGGGGTGGTGGTTCTGGAGGTGGAGGATCCGGTGGAGGAGG TTCT-3¢ In all ... study the majority of scFvs were detected in the cytosolic fraction (Fig 7A), and not in the T- cell culture supernatant (data not shown) These results indicate that the scFvs constructed with...

Ngày tải lên: 16/03/2014, 14:20