model studies of ecosystem engineering in plant communities
RKesneaorcwh arlteiclde ge and perception of pulmonary tuberculosis in pastoral communities in the middle and Lower Awash Valley of Afar region, Ethiopia docx
Ngày tải lên :
06/03/2014, 04:20
... living in single-room (Afar house), the tradition of sharing single cup among several individuals regardless of their healthy status could play a role in the exposure to and spread of PTB In ... medicine was also very high compared to the results of previous studies Page of 11 conducted in other parts of Ethiopia, either in communities [19,22] or in TB patients [12,13], as also seen in ... role in increasing the burden of TB [5] Very few individuals we studied considered the role of HIV/AIDS as a risk factor in PTB development On the other hand, our study of communities underlined...
- 11
- 630
- 0
Aptitude for Destruction, Volume 2 - Case Studies of Organizational Learning in Five Terrorist Groups pptx
Ngày tải lên :
22/03/2014, 23:20
... sustained changes that involve intentional action by or within a group at some point—such as one or more of the following: intentional seeking of new knowledge or new ways or doing things; intentional ... clothes to indicate their levels of religious attainment Members could rise through the ranks of the organization by paying initiation fees to participate in certain levels of training To join the ... commercially and another informal in the form of repeated experimentation The few instances of formal training focused on specialized expertise in how to operate things The informal training focused on...
- 216
- 307
- 0
Báo cáo khoa học: Reannotation of hypothetical ORFs in plant pathogen Erwinia carotovora subsp. atroseptica SCRI1043 pot
Ngày tải lên :
23/03/2014, 07:20
... methyltransferases Protein involved in catabolism of external DNA Addiction module toxin, RelE ⁄ StbE family Antitoxin of toxin-antitoxin stability system YicC N-terminal domain protein Twin-arginine translocation ... distinguishing between protein-coding and noncoding ORFs The difference between coding and noncoding sequences can be viewed intuitively using PCA PCA defines the correlation among the variables of ... accuracy of the algorithm Both the training set and the test set should include positive and negative samples In the Eca1043 genome, 80.6% of the whole-DNA sequences are coding and the remaining intergenic...
- 9
- 170
- 1
Báo cáo khoa học: P NMR studies of energy metabolism in xanthosine5¢-monophosphate overproducing Corynebacterium ammoniagenes pot
Ngày tải lên :
23/03/2014, 17:22
... growing medium were optimized to gain maximum XMP production (Table 1) As shown in Table 1, an increase in the glu/glc ratio (glu/glc) induced a significant increase in XMP production, and this increase ... switch in the carbon flux In Table 1, glu increased the XMP/Hyp ratio, being dependent on the increased level of glu/glc ratio up to 0.46, which mainly resulted from the extension of the length of ... in XMP production was coupled with a reduction in production of the by-product, hypoxanthine XMP production attained nearly plateau levels at a glu/glc molar ratio of 0.31 Further increases in...
- 5
- 304
- 0
Báo cáo vật lý: "Volumetric and Thermodynamic Studies of Molecular Interactions in Ternary Liquid Mixtures at 303, 308 and 313K" pptx
Ngày tải lên :
07/08/2014, 14:20
... value of viscosity increased with increasing concentrations of 1alkanols and decreased with increasing temperature As the number of hydrocarbon groups or the chain-length of the alcohol increased, ... that in the case of liquid systems, including electrolytic solutions, there is no serious harm in assuming cubic packing and equating b to 3.3 Gibb’s Free Energy (ΔG*) On the basis of Eyring rate ... variation in excess free volume as a function of the concentration of 1-alkanols in all systems The values of excess free volume were almost positive in all of the systems and decreased with increasing...
- 13
- 258
- 0
Báo cáo lâm nghiệp: "Local variations of ecosystem functions in Mediterranean evergreen oak woodland" ppsx
Ngày tải lên :
08/08/2014, 18:21
... number of pairs of points considered in each variogram lag class is indicated in figure The second step uses semivariogram parameters to interpolate values for points not measured using kriging ... = Estimation of these parameters were obtained using the GEOPACK software (Yates and Yates, 1989) Calculations were made considering 10 lag classes using a lag spacing of 1.8 m Using these parameters, ... year ranged from a minimum of 21 in 1992 to a maximum of 33 in 88 with a mean of 26.5 For each year, the semivariogram of leaf littertall have been fitted using the spherical model Table III shows...
- 10
- 270
- 0
Báo cáo y học: "Systematic review and meta-analysis of randomised trials and cohort studies of mycophenolate mofetil in lupus nephritis" pdf
Ngày tải lên :
09/08/2014, 08:23
... original authors (mainly urine protein excretion, serum creatinine or creatinine clearance, or a combination of these) and subsequent relapse Adverse events sought included mortality, infection (especially ... residual bias in observational studies and lack of blinding in randomised trials The amount of information for MMF is greater than for cyclophosphamide and azathioprine in this indication, and ... immunosuppressive effects of mycophenolate mofetil (MMF) Clin Transplant 1996, 10:77-84 Bullingham RE, Nicholls AJ, Kamm BR: Clinical pharmacokinetics of mycophenolate mofetil Clin Pharmacokinet 1998, 34:429-455...
- 10
- 433
- 0
Báo cáo khoa học: "Clinical review: The implications of experimental and clinical studies of recruitment maneuvers in acute lung injury" pptx
Ngày tải lên :
12/08/2014, 19:22
... volumes Those investigators showed that, after RMs, PEEP set at cmH2O above the lower inflection point was more effective in maintaining gas exchange and minimizing inflammation and lung injury than ... lower inflection point before a sustained inflation Loop B: tidal insuflation with a PEEP below the lower inflection point after a sustained inflation Loop C: PEEP higher than the lower inflection ... severely injures lungs does not lead to release of significant amounts of inflammatory cytokines by the lung in the absence of lipopolysaccharide challenge Likewise, in experimental studies other investigators...
- 7
- 287
- 0
Báo cáo y học: "A model analysis of static stress in the vestibular membranes" ppsx
Ngày tải lên :
13/08/2014, 16:20
... complex of interconnected chambers (utricle, ampulla and semicircular canal) [1] Modeling of these chambers individually with basic geometric shapes and joining them in series permits an emulation of ... enormous variety of living species, and the visible differences between the legions of individuals may all be a part of a single evolutionary spectrum In fact, individual differences in Darwin's view ... pressure Indeed hoop stress can vary from point to point within the membrane of a pressurized vessel of irregular shape, depending on the shape, thickness and curvature of the membrane at the point in...
- 8
- 366
- 0
Báo cáo y học: "Global transcriptome analysis reveals circadian regulation of key pathways in plant growth and development" potx
Ngày tải lên :
14/08/2014, 20:22
... -carotene Zeinoxanthin zeinoxanthin -carotene Zeaxanthin zeaxanthin Lutein lutein Violaxanthin violaxanthin ABA Figure Circadian co-regulation of metabolic pathways Circadian co-regulation of metabolic ... E: Integration of abscisic acid signalling into plant responses Plant Biol 2006, 8:314-325 Fleet CM, Sun TP: A DELLAcate balance: the role of gibberellin in plant morphogenesis Curr Opin Plant ... circadian-regulated genes ('C+E intersection') at the intersection of the combined Covington and Edwards datasets contains almost all of the circadian genes found by analysis of the individual Covington and Edwards...
- 18
- 400
- 0
The Function of PsbS Protein in Plant Photosynthesis Regulation
Ngày tải lên :
24/06/2015, 08:18
... is an inhibitor of qE [48] DCCD binding in plant carrying mutated PsbS was about 50% of the control in single mutants (E122Q or E226Q) and undetectable in the double mutant carrying glutamines ... to part of qE and qI shown in the figure After switching off the actinic light, recovery of Fm’ within a few minutes reflects relaxation of the qE component of NPQ F0 represents the minimal fluorescence ... lack of most of the pigment binding sites present in the other Lhc proteins [20,47] Results from Aspinall-O'Dea and coauthors, indicating zeaxanthin binding to PsbS in vitro [62], were found an...
- 17
- 357
- 0
Application of Industrial Engineering in Garment field
Ngày tải lên :
21/07/2015, 16:18
... Industrial Engineering In Garment Manufacturing DEFINITION: Industrial Engineering is concerned with the design, improvement and installation of integrated systems of people, materials, ... is the quantity of goods and services produced Industrial Engineering Techniques In Apparel Industry • • • One major technique of Industrial Engineering followed in the Apparel Industry is the ... are being used • MEASURE - Measurement of the quantity of the work involved in each element in terms of time • COMPILE - Compilation of the standard time for operation • DEFINE - Definition of the...
- 19
- 376
- 0
MOLECULAR AND PHYSIOLOGICAL STUDIES OF SALT TOLERANCE IN THE SALT SECRETOR MANGROVE AVICENNIA OFFICINALIS
Ngày tải lên :
09/09/2015, 08:13
... Determination of salt gland density in A officinalis leaves 67 Figure 3.4: Salt gland structure from A officinalis leaves 69 Figure 3.5: Estimation of ions in xylem sap of A officinalis ... Quantification of hormones in leaves of two-month-old A officinalis seedlings up on salt treatment 77 Figure 3.9: Quantification of hormones in roots of two-month-old A officinalis seedlings ... CCATTAGGTGGCCAGCTCTC 24 Annotation Cloning Cloning Cloning Cloning qRT-PCR primers qRT-PCR primers Cloning Cloning Cloning Cloning qRT-PCR primers qRT-PCR primers Cloning Cloning Cloning Cloning qRT-PCR primers...
- 218
- 765
- 0
Centrifuge model study of mixing quality in wet deep mixing
Ngày tải lên :
09/09/2015, 10:17
... (rev/min) VW Withdrawal velocity (rev/min) Vqu Coefficient of variation of unconfined compressive strength w Water cement ratio W Total amount of injected binder (kg/cm3) WP Amount of binder injection ... Coefficient of strength on over lapped face of improved ground c' Binder concentration in fraction by weight in the DM column c Fraction of model binder in the DM column COV Coefficient of variation ... Figure 2.31 Variation of COV at difference model withdrawal rate (DM installer A: single twisted-blades inclined at 45°, DM installer B: twisted-blades inclined at 45° arranged in double layers)...
- 338
- 244
- 0
Ion channeling studies of defect formation in gan and related materials
Ngày tải lên :
16/09/2015, 08:31
... surprising success After this, interest in GaN research grew rapidly as clear in Fig 1.1 and interest is being maintained due to essential position of GaN and its alloys in solid state lighting ... important role in semiconductor device fabrication Main uses of annealing are activation of implanted dopants, implantation induced damage removal, alloying of ohmic contacts and maximization of sheet ... backscattering similar to surface increasing χmin The dechannelling factor σD in case of stacking fault is given by, σD = χmin (4.18) Additional monolayer Figure 4.4: A schematic of a stacking fault...
- 124
- 442
- 0
High-Surface-Area Catalyst Design- Synthesis, Characterization, and Reaction Studies of Platinum Nanoparticles in Mesoporous SBA-15 Silica
Ngày tải lên :
08/10/2015, 23:16
... The slope of the line (not shown) at both temperatures is ∼1 verifying that the measured rate is independent of the influence of transport effects Table also contains a compilation of apparent ... The minimal change in SBA-15 physical parameters after incorporation of Pt into the silica reveals that there is no significant blocking of the SBA-15 channel by Pt particles 3.2.2 Efficient Incorporation ... explain the structure insensitivity of olefin hydrogenation reactions.44,66 The presence of this organic layer on the metal surface effectively washes out the original metal surface In the case, of...
- 11
- 471
- 0
Optical and electrical studies of silicon nanowires in photovoltaic applications
Ngày tải lên :
12/10/2015, 17:35
... possibility of integrating MEG into the carrier generation mechanism of SiNW PV devices It aims at fabricating an array of ultra-thin SiNWs in which MEG phenomenon could be detected In Chapter ... highlighting the advantages and promising prospect of SiNWs in the design and fabrication of third generation solar cells In previous works, SiNWs were fabricated using a variety of methods, which mainly ... development and prominent properties are presented briefly in Chapter 1.2 Integration of silicon nanowires into PV devices There has been increasing research interests in deploying nanostructures,...
- 92
- 396
- 0
Pharmacokinetic and pharmacodynamic studies of mycophenolic acid in renal transplant recipients
Ngày tải lên :
28/11/2015, 13:44
... concentration-time profile of total MPA in patients for conventional study following chronic oral dosing of MMF after fitting in two compartment model 117 Plasma concentration-time profile of free MPA in patients ... target of rapamycin Mammalian target of rapamycin Molecular weight cutoff Mizoribine Nicotinamide adenine dinucleotide Other race Every morning One compartment model Phosphate Buffer Saline Pharmacodynamic ... groups of multiple doing reported in literatures 16 Pharmacokinetic parameters of mycophenolic acid in different transplant groups of multiple doing reported in literatures 20 Pharmacokinetic...
- 207
- 246
- 0
Tài liệu SURVEY OF CASE STUDIES OF THE USE OF KNOWLEDGE MANAGEMENT IN SOFTWARE ENGINEERING docx
Ngày tải lên :
16/01/2014, 16:33
... organizational learning: Representing and maintaining knowledge in an experience base, in Proc Tenth Int Conf on Software Engineering and Knowledge Engineering, SEKE98, 1998 44 T Dingsứyr, A lifecycle ... years of conferences like the International Conference on Software Engineering, The Software Engineering and Knowledge Engineering Conference, the International Conference on Product Focused Software ... Sommerville, Software Engineering, Addison-Wesley, 1996 A Bryant, Its Engineering Jim but not as we know it Software Engineering Solution to the software crisis, or part of the problem?, in Proc Int...
- 24
- 705
- 0
Báo cáo khoa học: Insertion of the plant photosystem I subunit G into the thylakoid membrane In vitro and in vivo studies of wild-type and tagged versions of the protein doc
Ngày tải lên :
07/03/2014, 21:20
... disrupting protein–protein interactions within PSI, or by altering the conformation of the loop His-tags were employed in a topological study of the major light harvesting chlorophyll a ⁄ b binding ... shown in Fig 4C Interestingly, both tags are recognized more efficiently in the context of the PSI-G loop region than at the C-terminus Topology of PSI-G in vivo In order to examine the topology of ... or light harvesting complex (LHCI), consisting of four members (Lhca1–4) of the chlorophyll a ⁄ b binding protein family LHCI is bound along one side of PSI only, in the vicinity of the PSI-F and...
- 9
- 422
- 0