mixture of monoculture crops planted in strips on a farm
The effect of grammar teaching (syntax) in English on 5 to 16 year olds’ accuracy and quality in written composition potx
Ngày tải lên :
10/03/2014, 05:20
... to context and meaning Language awareness An approach to teaching about language that aims to raise awareness of different aspects of language, as opposed to formal grammar teaching ii Learning ... policy on grammar teaching and language awareness in England and Wales Its general recommendations were to increase language awareness among pupils by increasing it among teachers at both primary and ... considered part of teaching textual grammar 'Pedagogic' grammar The distillation (usually of a traditional grammar) as used in textbooks for first or second language teaching Punctuation Surface...
- 85
- 700
- 1
Effect of cd and as in soil on growth availability to plant
Ngày tải lên :
16/03/2014, 00:07
... contents of As and Cd in agricultural products were significantly increased as the concentrations of As and Cd in soils were increased, basically Table shows that the contents of As in edible part of ... 14-21 August 2002, Thailand KIM ET AL chain International agencies, such as the Food and Agriculture Organization (FAO) and the World Health Organization (WHO), are currently advocating compliance ... of As treated soils As the concentrations of Cd and As in soils were increased, the contents of Cd and As in agricultural products were significantly increased, basically The contents of Cd in...
- 9
- 379
- 0
Báo cáo khoa học: Prediction of coenzyme specificity in dehydrogenases ⁄ reductases A hidden Markov model-based method and its application on complete genomes doc
Ngày tải lên :
23/03/2014, 10:21
... oxidoreductases Flavin-containing amine oxidases FAD-dependent oxidoreductases Zinc-containing alcohol dehydrogenases Lactate ⁄ malate dehydrogenases UBA ⁄ THIF-type NAD ⁄ FAD binding fold Flavin-containing ... classification Only two FAD-binding proteins are lost (false negatives): one is classified as NADP-binding and the other is classified as false, i.e nonRossmann fold Among the NAD-binding proteins ... Oryza sativa and Xenopus tropicalis have many more 800 Archaea Bacteria Eukaryota 700 Rossmann Folds C-terminal catalytic domain consisting of a- helices only (PDB code 2pgd [4]) In the first part...
- 8
- 481
- 0
báo cáo sinh học:" Information needs of health care workers in developing countries: a literature review with a focus on Africa" doc
Ngày tải lên :
18/06/2014, 17:20
... India, Pakistan and Saudi Arabia A study in Kenya identified inadequate national guidelines as a cause of insufficient knowledge and practice: "The knowledge of 50% on type of care [for umbilical ... Agrawal A, et al.: Information and communication technology in cardiovascular disease prevention in developing countries: hype and hope Report of the International Collaboration on Information ... and African literature are available to health workers in Africa; which they prefer, and why? investigate further the link between lack of information and feelings of professional isolation and...
- 13
- 558
- 0
Báo cáo hóa học: "HARDY INEQUALITIES IN STRIPS ON RULED SURFACES" potx
Ngày tải lên :
22/06/2014, 21:20
... Hardy inequalities in strips on ruled surfaces At the same time, a couple of results showing that the attractive interaction due to bending can be eliminated by appropriate additional perturbations ... study and generalizations of the original inequality due to Hardy Interesting Hardy inequalities on noncompact Riemannian manifolds were established in [2] In the quantum-waveguide context, various ... paper Indeed, the authors of [11] considered a three-dimensional tube constructed by translating a noncircular two-dimensional cross-section along an in nite curve and obtained that the twisting...
- 10
- 346
- 0
Báo cáo nghiên cứu khoa học: "INFLUENCE OF INITIAL TANNIN CONCENTRATION IN MUST ON THE KINETICS OF WINE FERMENTATION, USING YEAST IMMOBILIZED IN CALCIUM ALGINATE GEL" pptx
Ngày tải lên :
22/07/2014, 02:21
... the traditional external gelation method [3] Yeast concentration was 25x106 cells/mL of gel bead Fermentation: The fermentation was conducted in an erlenmeyer containing 500 mL of must at 22-25oC ... were ameliorated CONCLUSION Increase in tannin content in must decreased the yeast growth, glucose utilization rate and ethanol production rate but increased the fermentation time and volatile acidity ... cảm quan rượu vang thành phẩm cải thiện REFERENCES [1] Bakoyianis, V., Koutinas, A A., Agelopoulos, K and Kanellaki, M Comparative study of kissiris, gamma alumina, and calcium alginate as supports...
- 6
- 507
- 1
Báo cáo lâm nghiệp: "Production potential and ecological stability of mixed forest stands in uplands – VI. A beech/larch stand on a mesotrophic site of the Křtiny Training Forest Enterprise" pot
Ngày tải lên :
07/08/2014, 03:22
... University of Agriculture, established permanent thinning plots in the traditional layout The total area of the stand part is 1.14 ha The stand is situated on a plateau sloping slightly northward at an ... population normality was rejected, nonlinear Box-Cox transformation and exponential transformation were used to obtain quality estimates of mean values and their interval estimates The programmes ... mensurational practice from the ratio of actual basal area of the particular species and tabular data On the basis of reduced areas determined in this way the species composi1400 1,400 results Analysis...
- 15
- 377
- 0
Báo cáo lâm nghiệp: "Nutrient status and field performance of tree seedlings planted in Mediterranean degraded areas" doc
Ngày tải lên :
08/08/2014, 00:22
... Evironmental factors of soil degradation in the Mediterranean area, in: Albaladejo J., Stocking M .A. , Díaz E (Eds.), Soil degradation and rehabilitation in Mediterranean environmental conditions, CSIC, ... using Olsen bicarbonate extraction [47] Climate is Mediterranean dry sub-humid with mean annual rainfall ranging from 384 to 592 mm (weather stations at Ayora, Embalse de Forata and Benissa) In ... 1994–1995, rainfall was around 60% of the historical annual average, whereas in 1993, rainfall was close to historical values in six sites (Ayora, Buñol, Martés M and L, Yátova and 2), and in two...
- 8
- 460
- 0
Báo cáo khoa học: "Effects of lime-induced differences in site on fine roots of oak" pptx
Ngày tải lên :
08/08/2014, 14:21
... liming Root health appeared to be improved by liming, as shown by the increased Ca/Al ratio [6], a higher live/dead ratio of fine roots in the initial years after liming and indications of a higher ... potential stress at an early stage [20] Changes in root concentrations may occur before those in foliage, so that fine root chemical analyses may be powerful indicators of mineral deficiencies at an ... explaining the high total values of Ca in the control plots; in the top layers liming increased the total amount of Ca Effects of liming on K were less clear: some increases and some decreases...
- 8
- 221
- 0
Báo cáo y học: "Hazards of tube thoracostomy in patients on a ventilator" doc
Ngày tải lên :
10/08/2014, 09:21
... separately in self- and mechanicalventilating patients along with considering the clinical settings as well as the specialty demands For instance efficient drainage of left-sided pleural effusion ... setting in “pre-drainage risk Consent Written informed consent was obtained from the patient for publication of this case report and accompanying images A copy of the written consent is available ... removed after insertion of another ICD in the pleural space We believe the BTS guidelines [1] require a new revision with the view to including the mechanical ventilation as a hazardous clinical setting...
- 2
- 383
- 0
Báo cáo thú y: "The effect of the combination of acids and tannin in diet on the performance and selected biochemical, haematological and antioxidant enzyme parameters in grower pig" docx
Ngày tải lên :
12/08/2014, 18:22
... all animals, there is a general increase in total serum protein, a decrease in albumin, and an increase in globulins with advancing age [42] Štukelj et al Acta Veterinaria Scandinavica 2010, ... analyser Cobas Mira (Hoffman La Roche Ltd, Basel, Switzerland) Haematological analyses CBC was determined immediately after collection with an automated haematological analyser (ABC Vet, Horiba ... biochemical parameters (Table 3), the level of protein, an indicator of adequacy of protein in terms of quality and quantity in the diet [42], at the beginning of the trial was below the lower value of...
- 8
- 469
- 0
Báo cáo y học: "Aplasia and Agenesis of the Frontal Sinus in Turkish Individuals: A Retrospective Study Using Dental Volumetric Tomograph"
Ngày tải lên :
25/10/2012, 11:04
... extending above a line tangential to the supraorbital margin (horizontal line) Frontal sinus aplasia is also defined by an oval-shaped sinus with the lateral margin medial to a vertical line drawn ... consideration during the pre-surgical planning related to the sinus In addition, a greater frequency of bilateral frontal sinus agenesis occurs among females than among males In males, unilateral frontal ... examining techniques and equipment In addition, constitutional (age, gender, hormones, and craniofacial configuration) and environmental (climatic conditions and local inflammations) factors control...
- 5
- 577
- 0
596 THE USE OF RELATIONSHIP MARKETING TECHNIQUES IN HIGHER EDUCATION A CASE STUDY
Ngày tải lên :
08/04/2013, 17:02
... Dalat 2.2.2 Chức năng, hiệu suất Marketing du lịch Dalat: Stephan Haeckel, giám đốc Viện Kinh doanh IBM, quan niệm “tương lai Marketing “một” chức doanh nghiệp, mà “cái” chức doanh nghiệp” Marketing ... Nam gần n a kỷ qua, vùng rau hoa lớn nước khu vực Dalat sản xuất 100.000 rau loại cung cấp cho thị trường Hồ Chí Minh, tỉnh ph a Nam, miền Trung xuất sang Nhật Bản, Đài Loan, Hồng Công, Singapore ... Các sở, ngành có liên quan tỉnh doanh nghiệp tập trung đầu tư nâng cấp khu nghỉ dưỡng đ a bàn, bật khu resort Hoàng Anh - Dalat, khu nghỉ mát resort Anna Mandara Villas Dalat, khu biệt thự Trần...
- 162
- 1.1K
- 2
Tài liệu The long-term reproductive health consequences of female genital cutting in rural Gambia: a community-based survey doc
Ngày tải lên :
13/02/2014, 16:20
... policy makers, activists and professionals in various ®elds It has been condemned as a violation of human rights; a manifestation of gender inequality and extremely damaging to sexuality and health ... large ethnic groups in The Gambia (Singhateh 1985) A national campaign to eliminate FGC in The Gambia was launched in 1997 In the same year, the government banned national radio and television ... rate in a study that was already sensitive because of the gynaecological examination Therefore the only data collected pertaining to sexual behaviour were marital status (including number of co-wives)...
- 11
- 558
- 0
Báo cáo khoa học: The pH dependence of kinetic isotope effects in monoamine oxidase A indicates stabilization of the neutral amine in the enzyme–substrate complex ppt
Ngày tải lên :
07/03/2014, 06:20
... purification of MAO A The gene encoding human liver MAO A was amplified from a cDNA clone obtained from MRC Geneservices (Cambridge, UK) using the primers 5¢-GTCTTCGAA ACCATGGAGAATCAAGAGAAGGCGAGTATCGCGG ... Inc., Palo Alto, CA, USA) The concentration of benzylamine was typically in the range 0.02–2 mm, and the assay was started by the addition of MAO A to a final concentration of 0.6 lm Michaelis–Menten ... dependence in MAO A R V Dunn et al Fig S5 Substrate dependence of the reductive halfreaction of MAO A- catalysed oxidation of PEA at pH 8.5 and 20 °C This material is available as part of the online article...
- 9
- 327
- 0
the relationship between corporate culture and the use of management accounting innovations in vietnamese companies a study of techcombank
Ngày tải lên :
13/03/2014, 14:20
... Therefore, indirectly, organizational culture can have an effect on competitive advantages of an organization when taking part in the international marketplace 2.2 Overview of the innovation of management ... of background information about management accounting innovations in Techcombank: 65% of twenty surveyed managers and accountants are aware of management accounting innovations in Techcombank ... innovation and invention in organizations According to the study by Zahariah Mohd Zain, Razanita Isahak, and Eelane K Ghani (2009), corporate culture plays an important role in changing “Organizational...
- 86
- 898
- 0
Báo cáo khoa học: New members of the brachyurins family in lobster include a trypsin-like enzyme with amino acid substitutions in the substrate-binding pocket potx
Ngày tải lên :
23/03/2014, 03:20
... acids ⁄ 237 acids ⁄ 237 acids ⁄ 237 acids ⁄ 237 acids ⁄ 249 amino amino amino amino amino 266 266 266 266 278 AATAAA ⁄ 13 nucleotides AATAAA ⁄ 13 nucleotides AATAAA ⁄ 10 nucleotides AATAAA ⁄ 13 nucleotides ... Perera et al 3498 25 25 25 25 27 acids ⁄ 14 acids ⁄ 14 acids ⁄ 14 acids ⁄ 14 acids ⁄ 14 amino amino amino amino amino 15 15 15 15 15 acids acids acids acids acids amino amino amino amino amino acids ... 5¢-GGACATCTCCTTCGGCTT-3¢ 5¢-AGTGACCAGCACAGATAGC-3¢ 5¢-GTGGATCCAGTGTTCGTCAT-3¢ 5¢-CCGTGCCCATCGTGTCTGA-3¢ 5¢-CCAGTAGACAAACCACTTCG-3¢ 5¢-CATACCTGGCTTCAAGATGC-3¢ 5¢-CAGGAATTGCCGATAGGATGC-3¢ 5¢-TACTTGCGTTCAGGGGGAGC-3¢...
- 13
- 474
- 0
báo cáo sinh học:" Human resources and the quality of emergency obstetric care in developing countries: a systematic review of the literature" potx
Ngày tải lên :
18/06/2014, 17:20
... discussion 283–294 Kayongo M, Rubardt M, Butera J, Abdullah M, Mboninyibuka D, Madili M: Making EmOC a reality – CARE's experiences in areas of high maternal mortality in Africa International Journal ... explanatory analytical studies; normative evaluation studies; and descriptive articles Based on an assessment of each component of the intervention against norms and criteria, normative evaluation ... Gerein N, Green A, Pearson S: The implications of shortages of health professionals for maternal health in sub-saharan Africa Reproductive Health Matters 2006, 14:40-50 Islam MT, Haque YA, Waxman...
- 12
- 640
- 0