... retail markets through export merchandising to increase profit and sustain growth Thanks to the Internet, small businesses can get in on the act as well without the need of establishing an international ... in the international market “The vision of the Company is to become a leading manufacturer and exporter of apparel by continuously excelling in quality, service, and customer satisfaction using ... processes and people.” Department functions and operations of an SPL industries Production Planning and Control Department Yarn Department Knitting Department Washing and dyeing Department...
Ngày tải lên: 21/07/2015, 16:54
... Kaplan-Meier method and log-rank test A P value < 0.05 was considered statistically significant RESULTS Baseline clinical, coronary angiographic and lesion characteristics are shown in Table and ... these initial trials indicate that the ZES is safe and reduces the rates of clinical and angiographic restenosis in patients with symptomatic coronary artery disease (CAD; 4) Also the safety and ... according to the modified ACC/AHA (American College of Cardiology / American Heart Association) classification (14) Overall, most lesions were located in the left anterior descending artery and...
Ngày tải lên: 25/10/2012, 11:18
Báo cáo y học: "Efficacy of Sirolimus-Eluting Stents Compared With Paclitaxel-Eluting Stents in an Unselected Population With Coronary Artery Disease: 24-Month Outcomes of Patients in a Prospective Non-randomized Registry in Southern Turkey&
... SES and PES cohorts A P value < 0.05 was considered statistically significant RESULTS Baseline clinical, angiographic, and lesion characteristics are shown in Tables and The baseline clinical ... similar according to the modified ACC/AHA (American College of Cardiology/American Heart Association) classification.22 Overall, most lesions were located in the left anterior descending artery and ... coronary artery binding graft; CK: creatine kinase; MACE: major adverse cardiac events; MI: myocardial infarction; PES: paclitaxel-eluting stent; RESEARCH: Rapamycin-Eluting Stent Evaluated at Rotterdam...
Ngày tải lên: 26/10/2012, 08:57
Báo cáo y học: "The characterisation of mucin in a mature ovarian teratoma occurring in an eight year old patient
... secretion and whether the organ is in a normal or diseased state As far as we know this is the first time an amino acid analysis has been done of purified mucin in an ovarian teratoma The observation ... normal human gastro-intestinal tract and reacted with fetal, precancerous and cancerous colonic mucosa but not with normal colon [17] The antibodies also reacted against mucins purified from gastric ... teratoma Amino acid Aspartic acid (D) Threonine (T) Serine (S) Glutamic acid (E) Proline (P) Glycine (G) Alanine (A) Cysteine (C) Valine (V) Isoleucine (I) Leucine (L) Tyrosine (Y) Phenylalanine...
Ngày tải lên: 26/10/2012, 10:03
Writing a Simple Program in an Assembly Language
... unpredictable what are stored there after it is turned on again In other words, you cannot determine what must be included in the RAM data area In the RAM, you can only reserve an area for writing data ... write as follows to prepare a separate section for storing the addition results in: SECTION ROM_DATA,DATA,LOCATE=H'1100 DATA1: DATA.B 10 DATA2: DATA.B 100 SECTION RAM_DATA,DATA,LOCATE=H'2000 ANSWER: ... and answers to calculations are stored in the destination operand Note that some instructions have only one operand (destination operand) or none at all Sample instruction with one operand Sample...
Ngày tải lên: 29/09/2013, 11:20
Sensor-based navigation of a mobile robot in an indoor environment
... one obtained after including the unknown obstacle in the data base and starting again the planning [15] In fact the main penalization due to unknown obstacles is the decreasing of the linear speed ... modeling the plant and another for the controller In fact, as pointed by Jordan and Rumelhart it is not necessary to work with an accurate model of the plant to obtain an efficient control Saerens ... On the beginning of the learning the robot is near a wall in an unknown Vr = min(Va , Cvg Vmin ), where Vmax and Vmin are the maximum and minimum chosen linear speed, respectively An example of...
Ngày tải lên: 23/10/2013, 15:15
Managing and Practicing OD in an IT Environment - A Structured Approach to Developing IT Project Teams
... (implementing new computers or software), database management and revision (ensuring proper data storage and access), hardware and software upgrades (replacing or enhancing existing assets), and network ... slips and turnover among the team The database analysts and the programmers are unable to agree on the proper ways to pass information back and forth between the interface and the database, and ... capturing and reinvesting IT project savings in a measurable way IT and the projects that create it are going to be an increasingly integral part of modern life in the years to come Most organizations...
Ngày tải lên: 24/10/2013, 08:20
Displaying an Image from a Database in a Web Forms Control
... containing the image from the database Create a SQL statement to retrieve the required image from the database and retrieve the image using a DataReader A DataTable or DataSet filled using a DataAdapter ... shown in Example 7-15 Example 7-15 File: ADOCookbookCS0707b.aspx.cs // Namespaces, variables, and constants using System; using System.Configuration; using System.Data; using System.Data.SqlClient; ... the image as a binary stream The BinaryWrite( ) method of the HttpResponse object writes a stream of binary characters to the HTTP output stream rather than a textual stream Response.BinaryWrite((byte[])dr["Photo"]);...
Ngày tải lên: 28/10/2013, 18:15
Displaying an Image from a Database in a Windows Forms Control
... CurrencyManager notifies all data-bound controls if the current item changes so that they can refresh their data The PropertyManager class inherits from the BindingManagerBase class and maintains ... BindingManagerBase object and either a CurrencyManager or PropertyManager object is returned depending on the type of data source: • • The CurrencyManager class inherits from the BindingManagerBase ... that are bound to the same data source so that they display information from the object within the data source, such as a row in a DataTable The BindingContext class is used to instantiate a BindingManagerBase...
Ngày tải lên: 28/10/2013, 18:15
Gián án Ụnit 1: A day in the life of...
... lead in: - It is Linh’sdaily routine -Do you have a daily routine? -is it same or different from Linh? 5ms 2.Pre-task: BRAIN STORM -ask ss think about some their activities in a day in m -after ... remember activities and time’s activities of Linh -2 ms for teams go to the board and write answers -team which more correct answer is winner * checking instruction (p.) *after ms T check answers and ... Stage / timing Prereading 5ms Activities warm-up GUESS THE ACTIVITIES * Instruction: -Divide class in to two teams: team A & team B -Show a video about linh’ daily routine in minute -ask ss...
Ngày tải lên: 02/12/2013, 19:11
Hoàn thiện công tác đào tạo và phát triển nhân lực tại công ty in ấn bao bi tân á châu
... chuyển hàng h a phục vụ sản xuất Công ty * Phân xưởng chế bản: Giúp doanh nghiệp thiết kế trang in, desiger, kẽm để in * Phân xưởng in: Giúp doanh nghiệp in biểu mẫu, bao bì, catalogue, in ấn tạp ... KINH DOANH C A CÔNG TY NĂM 2011-2013 Căn vào kết sản xuất kinh doanh năm qua nhu cầu thực tế thị trường, Công ty xây dựng chiến lược kinh doanh cho năm tới với quy mô tăng doanh thu 28%, số lao ... công ty, d a vào kế hoạch sản xuất, kinh doanh đơn vị, d a vào nhu cầu sản xuất, kinh doanh tốt Tuy nhiên qua bảng 2.8 công ty cần phối kết hợp phương pháp vấn, quan sát, để đ a kết xác mang tính...
Ngày tải lên: 22/12/2013, 15:01
Tài liệu Creating a Class That Participates in an Automatic Transaction ppt
... automatically in an existing transaction, to start a new transaction, or to not participate in a transaction The following steps prepare a class to participate in an automatic transaction: Derive the class ... transactions that span multiple remote databases and multiple resource managers Objects participating in automatic transactions not need to anticipate how they might be used within a transaction ... automatic transaction Once an object is marked to participate in a transaction, it will automatically execute within a transaction The object's transactional behavior is controlled by the value...
Ngày tải lên: 24/12/2013, 05:15
Tài liệu Make a Generic Search Form in an ASP.NET docx
... the Data Grid with the New Page Number Private Sub dgSearch_PageIndexChanged(ByVal source As Object, ByVal e As System.Web.UI.WebControls.DataGridPageChangedEventArgs) Handles dgSearch.PageIndexChanged ... that the various ADO.NET objects can be used Using the Session object and other State management methods is handy for creating pages that you want to use for more than one table You will find ... btnAccept Caption &Accept Name btnCancel Caption Button Name AllowPaging Button Z Caption DataGrid btnZ Caption Button Name &Cancel In the class module for the Web Form, add the following Private...
Ngày tải lên: 24/12/2013, 06:17
Tài liệu Building a RISC System in an FPGA ppt
... instructions, as you can see in Table Note that only signed char data use lbs ASSEMBLER write it using a jump Because inserting a jump may make other branches far, we repeat until no far branches remain ... effective address) Careful design and reuse will let you minimize the datapath area because the adder, with the immediate mux, can the effective address add, and the PC incrementer can also add branch ... removed any remaining 32-bit assumptions inherited from mips.md, and arranged to store long ints in register pairs, and call helper routines for mul, div, rem, and some shifts My port was up and...
Ngày tải lên: 26/01/2014, 14:20
Tài liệu Building a RISC System in an FPGA Part 2 docx
... registers are enabled by PCE IF branch AN ← PC0 += 2×disp8 BRANCH SELPC PCCE It indicates that all pipe stages are ready and the pipeline can advance IF jal call AN ← PC0 = SUM PCCE PCE is asserted ... [1] D Patterson and J Hennessy, Computer Organization and Design: The Hardware/Software Interface, Morgan Kaufmann, San Mateo, CA, 1994 www.circuitcellar.com © Circuit Cellar, The Magazine for ... bus • DCANNUL: annul DC stage • ACE (address clock enable): the next stage begins The buffers IRB and IMMB break out the instruction fields • EXANNUL: annul EX stage address AN1 5:0 (a datapath output)...
Ngày tải lên: 26/01/2014, 14:20
Tài liệu Building a RISC System in an FPGA Part 3 doc
... write address, one half clock to assert / CIRCUIT CELLAR® assert XA14:1, data LSB, XA0=1 assert /WE deassert /WE, hold XA and data assert data MSB, XA1=0 assert /WE deassert /WE, hold XA and data ... make ease-of-use tradeoffs in favor of core users Because FPGAs are malleable and FPGA SoC design is so new, I wanted an interface that can evolve to address new requirements without invalidating ... captures the next address AN1 4:1 at the start of each new memory transaction XA0 (XA_0) is the least significant bit of the external address It is a logic output and can change on either CLK...
Ngày tải lên: 26/01/2014, 14:20
Tài liệu Physics in a New Era An Overview doc
... Albert Narath, Lockheed Martin Corporation (retired), Venkatesh Narayanamurti, Harvard University, V Adrian Parsegian, National Institutes of Health, Julia Phillips, Sandia National Laboratories, ... Materials New Tools for Observation in the Quantum Regime Manipulating Atoms and Electrons New Materials Artificial Nanoscale Structures Quantum Information and the Engineering of Entangled States ... Scanning tunnel- QUANTUM MANIPULATION AND NEW MATERIALS 21 ing microscopes, for instance, can examine the electrons at each atom on a surface (see sidebar “Scanning Tunneling Microscope”), magnetic...
Ngày tải lên: 12/02/2014, 16:20
Tài liệu Báo cáo khoa học: The plasminogen activator inhibitor 2 transcript is destabilized via a multi-component 3¢ UTR localized adenylate and uridylate-rich instability element in an analogous manner to cytokines and oncogenes pdf
... CTTTGTTATTTATTATGCATTCCTATGGTGAGTT AACTCACCATAGGAATGCATAATAAATAACAAAG CTTTGTTAAAGCTTATGCATTCCTATGGTGAGTT AACTCACCATAGGAATGCATAAGCTTTAACAAAG CCTCTTACACTTGCTTTTGAC GCAAAGGTGCCTTTGAGGTTG GACCCCTTCATTGACCTCAACTA ... CGGAAGATCTGGGATCATGCCCATTTAG TACGAGATCTTAGCTACATTAAATAGGC GGGATCATGCCCAAGCTTATTTTCCTTACT AGTAAGGAAAATAAGCTTGGGCATGATCCC GCTCACTGCCTAAGCTTTGTAGCTAATAAAG CTTTATTAGCTACAAAGCTTAGGCAGTGAGC CTTTGTTATTTATTATGCATTCCTATGGTGAGTT ... simultaneously engaged in mRNA decay in an AREmediated manner [45], suggesting that the pathway of mammalian ARE-mediated mRNA decay can be flexible Recently, an excellent database compiling ARE...
Ngày tải lên: 16/02/2014, 09:20
Management of pulmonary tuberculosis patients in an urban setting in Zambia: a patient’s perspective ppt
... University of Zambia UNZA), and Macro International Inc: Zambia Demographic and Health Survey 2007 Calverton, Maryland, USA; CSO and Macro International Inc; 2009 World Health Organization: “TB Country ... and modifications incorporated in the final version The collected data was entered in an MS Access database using Epi Info™3.5.1 (Centers for Disease Control and Prevention, Atlanta, GA, USA), with ... patients regarding the disease, and factors affecting treatment compliance Int J Tuberc Lung Dis 1999, 3(4):300-309 Kilale AM, Mushi AK, Lema LA, Kunda J, Makasi CE, Mwaseba D, Range NS, Mfinanga...
Ngày tải lên: 06/03/2014, 04:20