... How the valence electrons are distributed in the molecular orbitals follows from the Aufbau principle: they are placed, one after the other, in the MOs, in the order of increasing energy The ... On the other hand, one AO of the central atom could be a nonbonding MO, which is empty in the carbenium ion, contains an electron in the radical, and contains the nonbonding electron pair in the ... and 1, which, in turn, is due to the fact that the s character of the Cspn-element bond increases in the same order Other things being equal, the shorter the bond, the stronger the bond An immediate...
Ngày tải lên: 02/04/2014, 16:01
... Meng Haiying, Hou Yiping: New reseach hotpots of HLA, Chin J.Med Genet, 2000 17 (5), 355 - 357 Xu xingpei, Wang Shaoying, Cao Jianying: Study on DNA typing of HLA - II class genes of Chinese Buyi ... Shen Jingjing, Guan Xiaofan, Yang Ze et al: Allels at five HLA - II class determined in Weiwuer nationality in North - Western of China Chin.J.Med Genet 2000, 17 3), 219 220 D Chandanayingyong, ... alleles in Jing nationality of Central Vietnam Methods: Applied PCR-SSP technique to determine the polymorphism of the HLA-DQA1 alleles of 214 healthy children and yoth, unrelated individuals in Centre...
Ngày tải lên: 25/03/2014, 03:22
Tài liệu Báo cáo Y học: Steady-state kinetics of the glutaminase reaction of CTP synthase from Lactococcus lactis The role of the allosteric activator GTP in coupling between glutamine hydrolysis and CTP synthesis potx
... since the heat evolved representing this activity is included in the baseline of the experiment Therefore, the assay only measures the rate increase due to the addition of GTP with a resulting ... described in the legend to the indicated Fig Glutaminase refers to hydrolysis of glutamine without CTP synthesis taking place b In the absence of GTP c Saturated with GTP d The other kinetic parameters ... CTP synthesis that involves rearrangements of the monomer that brings together the glutaminase site and the active site (C) GTP locks the enzyme in the active form for CTP synthesis and thereby...
Ngày tải lên: 21/02/2014, 15:20
Báo cáo khoa học: Enzymatic oxidation of NADP+ to its 4-oxo derivative is a side-reaction displayed only by the adrenodoxin reductase type of ferredoxin-NADP+ reductases potx
... nicotinamide ring of the bound ligand in the active site [14] In this view, it is significant that the perturbations induced by NADPO binding to FprA were more intense than those induced by the other ... alteration of the isoalloxazine microenvironment induced by the binding of the NMN group The small structural differences in the nicotinamide rings of NADP+, NADPO and thio-NADP+ resulted in small ... values of NADPO were determined by fitting the experimental data points to the theoretical equation for the competitive inhibition mechanism, using the nonlinear fitting feature of grafit (Erithacus...
Ngày tải lên: 16/03/2014, 11:20
Báo cáo khoa học: Trans-splicing of a mutated glycosylasparaginase mRNA sequence by a group I ribozyme deficient in hydrolysis pptx
... splicing activity in vitro The most common disorder of glycoprotein degradation, AGU, is caused by mutations in GA [22] The nucleotides flanking the intron insertion site in GA RNA, upstream of the ... nt region of the 3¢ exon in the ribozymes, resulting in a 361 nt protected region for the trans-spliced RNA The probe was in vitro transcribed containing additional vector sequences in order to ... http://www.fagmed uit.no/info/imb/amb Fig Cis-splicing experiments of DiGIR2derived ribozymes inserted into GA RNA sequences (A) Top; schematic map of the human GA ORF indicating the intron insertion site...
Ngày tải lên: 23/03/2014, 13:20
Báo cáo y học: "The Diels-Alder-Reaction with inverse-Electron-Demand, a very efficient versatile Click-Reaction Concept for proper Ligation of variable molecular Partners"
... double bond inside of the cyclobutene ring The presence of a further double bond inside of the cyclohexene ring is not of relevance due to the inactivity of this double bond in the DARinv The anhydride ... reciprocally proportional to the ring’s size; the minimum is reached with the six-atom ring, and in larger rings the reaction rate is slightly increasing Derivatives of the cyclobutene dispose still ... effects on the diene A., which induce a decrease of the electron density of the tetrazine ring Whereas in contrast the R3 features a +I effect resulting in a relative high electron densitiy in the dienophile...
Ngày tải lên: 26/10/2012, 09:39
Phát hiện loài Fusarium spp. Gây bệnh thối xương rồng (Cactaceae) bằng phương pháp Polymerase Chain Reaction
... với PCR Recombinant PCR Kỹ thuật footprinting DnaseI Multiplex PCR HLA DNA (các kháng nguyên bạch cầu ngƣời) 2.7 Giới thiệu sơ lƣợc kỹ thuật DNA sequencing Kỹ thuật DNA sequencing công trình ... triển xƣơng rồng Tp Hồ Chí Minh giới 2.2.3.1 Tại Tp Hồ Chí Minh .5 2.2.3.2 Trên giới 2.2.4 Đặc tính thực vật điều kiện sinh thái xƣơng rồng (theo Huỳnh Văn Thới, 2004) ... địa bàn Tp Hồ Chí Minh phần lớn xƣơng rồng nhập từ Trung Quốc đặc biệt dùng để ghép Thực tế cho thấy ngày địa bàn Tp Hồ Chí Minh có nhiều hộ dân kinh doanh xƣơng rồng Cụ thể theo điều tra cách...
Ngày tải lên: 17/11/2012, 09:45
ỨNG DỤNG PHƯƠNG PHÁP PCR (POLYMERASE CHAIN REACTION) VÀ PHƯƠNG PHÁP NUÔI CẤY ĐỂ KHẢO SÁT SỰ NHIỄM VI SINH VẬT GÂY BỆNH TRONG THỰC PHẨM ĐƯỜNG PHỐ
... tố tróc vảy (exfoliative toxin-ET): gồm hai loại ETA ETB gây triệu chứng da kết vảy nứt nẻ da -Độc tố phá màng: bao gồm α-toxin, β-toxin, δ-toxin, γ-toxin leucocidin Chúng có khả phá hủy màng ... vi sinh vật khác Q trình tăng sinh gồm hai giai đoạn: Giai đoạn tăng sinh giai đoạn tăng sinh chọn lọc mơi trường đặc trưng - Phân lập: q trình tách vi sinh vật mục tiêu khỏi quần thể vi sinh ... dẫn đến lỵ - Độc tố thần kinh: gọi Shigatoxin, độc tố mạnh thấy S dysenteriae 1, tương tự verotoxin E coli O157:H7, tác động đặc hiệu vào hệ thần kinh Ngồi ra, Shigatoxin coi tác nhân gây thương...
Ngày tải lên: 16/03/2013, 09:26
Xây dựng Quy trình phát hiện Escherichia Coli trong thực phẩm bằng phương pháp PCR(Polumerase Chain Reaction) và thử nghiệm ứng dụng
... duncid, glycerol; lên men inulin, pectin, adonite; không lên men dextrin, amidon, glycogen, inositol, cellobiose Vi khuẩn thường sinh indol, không sinh urea H2S, có sinh lysin decarboxylase, không ... sinh với nguồn cacbon glucose, galactose, lactose, maltose, arabinose, xylose, ramnose, mannitol, fructose; lên men hay không lên men saccharose, rafinose, esculin, duncid, glycerol; lên men inulin, ... thường sinh domoic, axit amin gây độc cho hệ thần kinh thể + Tảo lam: có nhiều loại, tạo nhiều loại độc tố khác nhau, đặc biệt chất có hiệu ứng gây độc cho hệ thần kinh Aphanizomenonf aquae sinh...
Ngày tải lên: 16/03/2013, 09:26
Salmonella trong sản phẩm thuỷ sản - Phương pháp định tính bằng kỹ thuật Polymerase Chain Reaction
... Gồm hai mồi invA1 invA2 thiết lập cách 520 bp gen invA có vai trò trình xâm nhiễm Salmonella vào thành ruột động vật người Trình tự hai mồi sau : invA1 : 5' - TTGTTACGGCTATTTTGACCA -3' invA2 : 5' ... dụng phải tuân thủ theo hướng dẫn nhà sản xuất Trong trường hợp sử dụng vật liệu hoá chất riêng lẻ, độ tinh khiết thành phần nước pha chế phải đảm bảo chất lượng dùng cho vi sinh sinh học phân tử ... bổ sung phần khối lượng môi trường tăng sinh Nếu lấy 25 g mẫu, phải bổ sung 225 g môi trường tăng sinh dung dịch pepton đệm ủ mẫu có môi trường tăng sinh nhiệt độ 37,0 oC 1,0oC khoảng 18 giờ...
Ngày tải lên: 20/03/2013, 08:34
KỸ THUẬT PCR (POLYMERASE CHAIN REACTION)
... sai để tìm gen mã hóa protein cụ thể tìm gen tương đồng Việc tách đặc trưng hóa protein việc phổ biến hóa sinh học Ví dụ, ta tách protein mà đầu amin có trình tự axit amin: Met – Ile – Trp – Pro ... mối quan hệ cấu trúc chức đại phân tử sinh học vận hành kiểm soát trình sinh hóa tế bào Trọng tâm sinh học phân tử việc nghiên cứu đại phân tử ADN, ARN Protein trình tái bản, phiên mã dịch mã Trong ... nhân loại trải qua cách mạng sinh học, vấn đề sinh học phân tử (các trình lưu trữ, truyền đạt biểu thông tin di truyền mức độ phân tử) phận cách mạng Các kiến thức sinh học phân tử cho phép giải...
Ngày tải lên: 24/04/2013, 15:41
Extract face sequences from video
... tập tin viết tập tin thứ hai, định dạng nén khác o // ImageIO.c o // Example showing how to read and write images o #include "cv.h" o #include "highgui.h" o #include o int main(int ... Capture.c // Example showing how to connect to a webcam and capture // video frames #include "stdio.h" #include "string.h" #include "cv.h" #include "highgui.h" int main(int argc, char ** argv) ... ConvertToGray.c o // Example showing how to convert an image from color o // to grayscale o #include "stdio.h" o #include "string.h" o #include "cv.h" o #include "highgui.h" o int main(int argc, char** argv)...
Ngày tải lên: 26/04/2013, 14:55
Sự hòa hợp giữa các thì (Sequence of tenses)
... 3 They were still waiting there when I got there a b c d e f while I was having breakfast I have felt much better since I have been there since I have been watching TV since I came there ... Further Practice: Activity 1: Give the correct form of the verbs in parentheses (Pair work) He walked up and down until he (be) reassured by corner until you come back with the car this the ... from the university/ have it was a puppy/ was born/ became his graduated from college? companion j am working/ am doing my homework arrived at/ went to the station k he is explaining the lesson/...
Ngày tải lên: 09/06/2013, 01:26
alken reaction
... Halides What is the product? Carbocation formation is the rate-limiting step a more stable carbocation Carbocation Stabilities Alkyl groups decrease the concentration of positive charge in the carbocation ... Markovnikov’s Rule The electrophile adds to the sp2 carbon that is bonded to the greater number of hydrogens In a regioselective reaction, one constitutional isomer is the major or the only product ... rearrange … Carbocation Rearrangement Ring Expansion a more stable carbocation Addition of Halogens to Alkene Addition of Halogens in the Presence of Water Consider the transition states … Oxymercuration...
Ngày tải lên: 28/06/2013, 01:25
KHAI THÁC D. LI.U ESTs (EXPRESSED SEQUENCE TAGs) . CHI CAM CHANH (CITRUS) CHO VI.C PHÁT TRI.N MARKER PHÂN T. SSR (SIMPLE SEQUENCE REPEATS)
... These data were put into relational database and integrated SSR finder tool into the BUILDING SSRs DATABASE of Citrus Website After cleaning, masking repeat, vector and organelle sequences, the ... Transfer Protocol NCBI the National Center for Biotechnology Information NIG the National Institute of Genetics NIH the National Institutes of Health NLM the Nation Library of Medicine Perl Practical ... DATA MINING FOR DEVELOPING SIMPLE SEQUENCE REPEATS (SSR) MARKER IN EXPRESSED SEQUENCE TAGS (ESTs) FROM CITRUS Supervisor: Dr Trần Thị Dung Bsc Lƣu Phúc Lợi The research was carried out at the department...
Ngày tải lên: 03/09/2013, 10:00
ANALYSIS OF HYDROXYL RADICAL GENERATION IN ADVANCED OXIDATION PROCESS -EFFECT OF HUMIC SUBSTANCES DURING OZONATION
... supported in part by Grants -in- Aid of Scientific Research, for Research in Priority Areas, for Cooperative Research, for General Science Research, and for Developmental Scientific Research from the Ministry ... accidentally contaminated in the raw water in 2000 The presence of 10 ppb 3-chlorophenol increases the initial velocities of OH radical generation to 0.0031 and 0.0055 µM/s at the 20 and 30 µM ... enough to produce the same initial velocity of OH radical generation as that without 3-chlorophenol The kinetic equation for the enhancing effect of 3-chlorophenol obtained in the present paper...
Ngày tải lên: 05/09/2013, 08:40
Application of Hydrothermal Reaction to Biodegradability Improvement of Refractory Pollutants: Structural Conversion of Di- and Trichloroacetic Acid to Biodegradable Products
... 2002) In the previous research [11], it was reported that BOD values of products induced from MCAA increased until 1,330 mg / L in min, then remained in spite of increasing reaction time In that ... and MPa within 60 The desired pressure was obtained by adjusting the initial sample volume using the data on steam table During the experiments, reaction pressure was verified using the pressure ... attached the batch reactor apparatus In each experiment, sample was placed into the reactor The reactor was sealed, and then the air inside was replaced with pure nitrogen gas The reactor was put into...
Ngày tải lên: 05/09/2013, 08:40
Tolerance Level of Dissolved Oxygen to Feed into Anaerobic Ammonium Oxidation (anammox) Reactor
... Synthetic medium (described below) was continuously fed into the reactor In order to collect the enriched sludge adhering to the non-woven fabric carriers, the non-woven fabric was washed in ... No.2, 2011 using the indophenol method (Weatherburn, 1967) The nitrite and nitrate concentrations were determined by using ion chromatography (ICS-1500, Dionex, USA) The nitrogen loading rate and ... continuous water treatment test (Fig 1) The volume of the reactor was 500 mL, and 100 mL of the gel carrier cubes was placed inside the reactor (packing ratio, 20%) The reactors were operated in...
Ngày tải lên: 05/09/2013, 10:17