maspin a novel serine protease inhibitor
Báo cáo khoa học: A novel serine protease highly expressed in the pancreas is expressed in various kinds of cancer cells potx
Ngày tải lên :
16/03/2014, 23:20
... plasminogen activator Nature 377, 340–344 Hirata A, Yoshida S, Inoue N, Matsumoto-Miyai K, Ninomiya A, Taniguchi M, Matsuyama T, Kato K, Iizasa H, Kataoka Y, Yoshida N & Shiosaka S (2001) Abnormalities ... Prosemin acted enzymatically on Pro-Phe-Arg-MCA and Boc-Val-Leu-Arg4919 A novel serine protease in various cancer cells MCA, although it preferentially cleaved Boc-Glu(Obzl) and Gln-Ala-Arg-MCA as ... from the human trypsinogen prepro sequence was amplified from human pancreatic cDNA using the primer set (forward, CCCA AGCTTACCATGAATCTACTCCTGAT; reverse, GTTG GTACCTTGTCATCATCATCAAAGG), and inserted...
- 13
- 483
- 0
Structural and functional characterization of TRX16, a thioredoxinlike protein and altering substrate specificity of a serine protease inhibitor
Ngày tải lên :
09/09/2015, 18:55
... (peginterferon alfa-2b) PEGasys® (peginterferon alfa- 2a) Neulasta™ (pegfilgrastim) Oncaspar® (pegaspargase) Aranesp® (darbepoetin alfa) Somavert® (pegvisomant) Family Indication Modification Property ... Farré and Casado, 2001; Laroux et al., 2001), atherosclerosis and other cardiovascular disorders, inflammation and chronic inflammation (Laroux et al., 2001; Latha and Babu, 2001), burns (Latha ... of amylosucrase Van der Veen et al 2004 Generation of novel DNA polymerases from a combination of rat DNA polymerase beta and African swine fever virus DNA polymerase X Generation of novel β-lactamase...
- 145
- 254
- 0
Báo cáo khoa học: Effects of a novel arginine methyltransferase inhibitor on T-helper cell cytokine production pot
Ngày tải lên :
06/03/2014, 11:20
... [pii] Purandare AV, Chen Z, Huynh T, Pang S, Geng J, Vaccaro W, Poss MA, Oconnell J, Nowak K & Jayaraman L (2008) Pyrazole inhibitors of coactivator associated arginine methyltransferase (CARM1) ... modify and regulate several critical immunomodulatory proteins Post-translational modifications within T-cell-receptor signaling cascades allow T lymphocytes to initiate a rapid and appropriate immune ... (M.G.F.) K .A. M is the recipient of an Arthritis Investigator Award and the Donald and Delia Baxter Foundation Young Career Scientist Award References Lin WJ, Gary JD, Yang MC, Clarke S & Herschman HR...
- 13
- 646
- 0
design, synthesis, and biological evaluation of new anti-cancer nitrogen-containing combretastatins and novel cysteine protease inhibitors for the treatment of chagas
Ngày tải lên :
14/11/2014, 11:32
... against cruzain and cathepsin L in order to treat a devastating parasitic disease known as Chagas which is caused by a parasite called Trypanosoma cruzi Cruzain, which is the major cysteine protease ... as anticancer or antineoplastic agents, and their administration is known as cancer chemotherapy.11,20 Unfortunately, these chemicals can also damage healthy cells, especially the ones that are ... also like to thank Dr Kathleen Kuhler for all her help and suggestions she gave me during the course of my studies I am greatly thankful to Nancy Kallus, Barbara Rauls, Adonna Cook and Andrea...
- 516
- 254
- 0
Structural studies of cysteine and serine protease inhibitors towards therapeutic applications
Ngày tải lên :
14/09/2015, 14:09
... infections(Lecaille et al, 2002) Calpains are nonlysosomal cysteine proteases found in almost all mammalian and avian cells Calpains perform limited proteolysis and are found to activate various kinases and ... cysteine proteases having the catalytic triad Cys-His-Asp/Asn The catalytic reaction of Cysteine proteases takes place similar to serine proteases in two phases – (a) acylation and (b) deacylation In ... cause Chagas’ disease Papain and Caricain from the papaya plant and Actinidin (from kiwi fruit) are well known plant proteases 35 Table 1.2 Classification of cysteine proteases (Leung-Toung et al...
- 202
- 473
- 0
Tài liệu Báo cáo khoa học: TMPRSS13, a type II transmembrane serine protease, is inhibited by hepatocyte growth factor activator inhibitor type 1 and activates pro-hepatocyte growth factor pdf
Ngày tải lên :
15/02/2014, 01:20
... Tsubouchi H, Naka D, Takahashi K, Okigaki M, Arakaki N, Nakayama H, Hirono S, Sakiyama O, Takahashi K et al (1989) Molecular cloning and sequence analysis of cDNA for human hepatocyte growth factor Biochem ... (1999) Purification and characterization of a complex containing matriptase and a Kunitz-type serine protease inhibitor from human milk J Biol Chem 274, 18237–18242 Tanaka H, Nagaike K, Takeda N, Itoh ... sets: 5¢-TCCCATCTGTAGCAGCA ACT-3¢ and 5¢-GGATTTTCTGAATCGCACCT-3¢ for TMPRSS13 (34 cycles), and 5¢-ATGGAGGCTGCTTGG GCAACA-3¢ and 5¢-ACAGGCAGCCTCGTCGGAGG-3¢ for HAI-1 (26 cycles) The GAPDH-specific...
- 13
- 641
- 0
Tài liệu Báo cáo khoa học: C-Terminal extension of a plant cysteine protease modulates proteolytic activity through a partial inhibitory mechanism doc
Ngày tải lên :
14/02/2014, 14:20
... N-Pro 208 aa 34 aa CT - ex Stop 114 aa Xho1 365 aa 24 aa 208 aa N-Pro N Pro II 24 aa Protease domain BamH H1 Start I 114 aa Pre A S Dutta et al Protease domain CT - ex 34 aa III 208 aa N-Pro NP ... (isolated from the latex of Ervatamia coronaria in our laboratory) and papain from Carica papaya (Merck, Kenilworth, NJ, USA)], two serine proteases [trypsin and chymotrypsin from bovine pancreas ... latex of Ervatamia coronaria Biosci Biotechnol Biochem 62, 1947–1955 15 GuhaThakurta P, Biswas S, Chakrabarti C, Sundd M, Jagannadham MV & Dattagupta JK (2004) Structural basis of the unusual...
- 13
- 759
- 0
Tài liệu Báo cáo khoa học: Electrostatic role of aromatic ring stacking in the pH-sensitive modulation of a chymotrypsin-type serine protease, Achromobacter protease I pdf
Ngày tải lên :
21/02/2014, 03:20
... importance of the aspartate in the catalytic triad is not fully understood because several serine proteases not have an aspartate as the catalytic apparatus M NaCl However, for chymotrypsin-type serine ... side-chain at residue 210 is dispensable, as shown by the fact that H21 0A and H210S are as active as native API with VLK-MCA as a substrate (Table 1) This means that Trp169 does not play a role as an ... Asp113 and His210, rather than a catalytic triad ACKNOWLEDGEMENT We are grateful to Dr T Yamazaki for NMR measurements, Y Yagi for the amino acid analysis, and Y Yoshimura for the sequence analysis...
- 7
- 603
- 0
Báo cáo khoa học: A novel inhibitor of indole-3-glycerol phosphate synthase with activity against multidrug-resistant Mycobacterium tuberculosis pptx
Ngày tải lên :
07/03/2014, 03:20
... GACCTCATGACGGCGGACGTGGACCG Down: CGGTCCACGTCCGCCGTCATGAGGTC Ser64 fi Ala Glu168 fi Ala Val169 fi Ala His170 fi Ala Asn189 fi Ala Arg191 fi Ala Asp192 fi Ala Leu193 fi Ala Leu196 fi Ala The concentrations ... Up: CACTCGTCGAGGCCCATACCGAGCAG Down: CTGCTCGGTATGGGCCTCGACGAGTG Up: CGTCGAGGTCGCTACCGAGCAGGAAG Down: CTTCCTGCTCGGTAGCGACCTCGACG Up: GGTGATTGGCGTTGCCGCCCGCGACC Down: GGTCGCGGGCGGCAACGCCAATCACC ... Ala Up: CAAGCGCGCTAGTGCTTCGGCAGGCG Down: CGCCTGCCGAAGCACTAGCGCGCTTG Up: CGCTAGTCCTGCGGCAGGCGCATTGG Down: CCAATGCGCCTGCCGCAGGACTAGCG Up: CAGCACTCGTCGCGGTCCATACCGAG Down: CTCGGTATGGACCGCGACGAGTGCTG...
- 11
- 440
- 0
Báo cáo khoa học: Enhanced peptide secretion by gene disruption of CYM1, a novel protease in Saccharomyces cerevisiae doc
Ngày tải lên :
07/03/2014, 16:20
... MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa Euroscarf [16] ATCC [15] This study This study This study This study This study This study Euroscarf [16] ... Y1014 8a Y14953 Y1622 4a Y1498 4a Y17144 Y13211 Y13801 Y11941 Y11960 Y12296 Y15370 10864B Y11749 Y16248 10231B Y14266 LJY430 LJY431 LJY432 MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa ... undergoes a- secretase-type cleavage, but Yps1p and Yps2p were identified as the active enzymes [5] Our data indicates that yeast contain a metalloprotease, which could be a novel a- secretase, in addition...
- 10
- 631
- 0
Báo cáo khoa học: Hepatocyte growth factor activator (HGFA): a serine protease that links tissue injury to activation of hepatocyte growth factor pdf
Ngày tải lên :
15/03/2014, 11:20
... Gohda E, Tsubouchi H, Nakayama H, Hirono S, Sakiyama O, Takahashi K, Miyazaki H, Hashimoto S & Daikuhara Y (1988) Purification and partial characterization of hepatocyte growth factor from plasma ... of a patient with fulminant hepatic failure J Clin Invest 81, 414–419 Miyazawa K, Tsubouchi H, Naka D, Takahashi K, Okigaki M, Arakaki N, Nakayama H, Hirono S, Sakiyama O, Takahashi K et al (1989) ... growth factor activator K Miyazawa agonist ⁄ antagonist activity J Biol Chem 271, 13110– 13115 31 Kaibori M, Inoue T, Sakakura Y, Oda M, Nagahama T, Kwon AH, Kamiyama Y, Miyazawa K & Okumura T (2002)...
- 7
- 502
- 0
Báo cáo khoa học: Macrocypins, a family of cysteine protease inhibitors from the basidiomycete Macrolepiota procera pot
Ngày tải lên :
16/03/2014, 02:20
... Sabotic et al dues, which, on account of its unique characteristics, was assigned to a new family of cysteine protease inhibitors, I48 in the merops database inhibitor classification, also named ... legumain inhibition and Ki values in the nanomolar range for papain-like proteases, contrasts with those of other macrocypins that inhibit both papain-like proteases and legumain with Ki values ... with Z-Ala-Ala-Asn-AMC as the substrate, while stopped assays were performed for cathepsins K, S and B using Z-Phe-Arg-AMC as the substrate and for cathepsin H with Arg-AMC as the substrate [6]...
- 12
- 368
- 0
Báo cáo Y học: The role of the second binding loop of the cysteine protease inhibitor, cystatin A (stefin A), in stabilizing complexes with target proteases is exerted predominantly by Leu73 pdf
Ngày tải lên :
17/03/2014, 10:20
... the manufacturer GTATTCAAAAGTGGTCCCGGACAAAATGAGGACTTG TCCGGGACCACTTTTGAATACTTTCAAGTGCATATATTTATT CAAAAGTCTTGGCGGACAAAATGAGGACTTGGTAC CATTTTGTCCGCCAAGACTTTTGAATACTTTCAAGTGC CTTCCCGGAGGAAATGAGGACTTGGTACTTACTG ... CTTCCCGGAGGAAATGAGGACTTGGTACTTACTG CCTCATTTCCTCCGGGAAGACTTTTGAATAC CGGACAAGGTGAGGACTTGGTACTTACTGGATAC CAAGTCCTCACCTTGTCCGGGAAGACTTTTG Proteases Papain (EC 3.4.22.2) was purified, stored as inactive S-(methylthio)papain ... Asn77) to protease binding (see Fig 1A) Four recombinant cystatin A variants with Gly replacing each of these amino acids were prepared, and their interaction with papain, cathepsin L, and cathepsin...
- 10
- 533
- 0
Báo cáo khoa học: Inhibitory properties and solution structure of a potent Bowman–Birk protease inhibitor from lentil (Lens culinaris, L) seeds ppt
Ngày tải lên :
23/03/2014, 10:21
... Statistics for the total amount of experimental data are reported in Table A simulated annealing (SA) procedure was used starting from a randomly generated linear polypeptide chain The actual ... water and dialysed at C against Milli-Q water overnight The solution was heated in a water bath at 80 C for 10 min, cooled on ice and centrifuged as already described The clear supernatant was ... inammation-mediating proteases [16] More recently, a number of patents on the use of BBIs against various apparently unrelated diseases have appeared [1719] The molecular basis of these BBI activities...
- 16
- 518
- 0
Báo cáo khoa học: Local binding with globally distributed changes in a small protease inhibitor upon enzyme binding ppt
Ngày tải lên :
23/03/2014, 10:21
... Sottrup-Jensen L, Aspan A, Hall M & Soder¨ hall K (1997) Pacifastin, a novel 155-kDa heterodimeric proteinase inhibitor containing a unique transferrin chain Proc Natl Acad Sci USA 94, 6682–6687 ... residues classified as ‘scaffold’ Our findings indicate that inhibitors of the pacifastin family have a special design bringing together the dynamical features of peptides and structural organization, ... Ha, Ca and Cb chemical shift indices were calculated according to the procedures described by Wishart et al [37,38] Fitting of relaxation and dynamical parameters Fitting of R1 and R2 rates and...
- 12
- 396
- 0
Báo cáo khoa học: Crystal structure determination and inhibition studies of a novel xylanase and a-amylase inhibitor protein (XAIP) from Scadoxus multiflorus pot
Ngày tải lên :
29/03/2014, 09:20
... that XAIP associates with GH11 xylanase and GH13 a- amylase, as well as with both xylanase and a- amylase simultaneously Tissue distribution of XAIP The output of SDS–PAGE for the samples obtained ... (2003) Kinetics and energetics of the binding between barley alpha-amylase ⁄ subtilisin inhibitor and barley alpha-amylase analyzed by surface plasmon resonance and isothermal titration calorimetry ... known amino acid sequence of Ala–Asn–Leu–Asp–Ile– Ala–Val, which was obtained using automatic sequencing from Edman degradation [34] The reverse primer 5¢CCANCCYTCNCCNARDAYTT-3¢ was degenerated...
- 15
- 399
- 0
Báo cáo khoa học: A novel, promoter-based, target-specific assay identifies 2-deoxy-D-glucose as an inhibitor of globotriaosylceramide biosynthesis docx
Ngày tải lên :
30/03/2014, 01:20
... gene was amplified by PCR using HeLa cell genomic DNA as a template The following PCR primers were used: 5¢-TGAGTCGACTCAG CTCTTGGAGGGGCAACA-3¢ and 5¢-GCGCGCACAAA TGTCGCCTCCAGAACA-3¢ The amplified ... 14646–14652 Ishii A, Ohta M, Watanabe Y, Matsuda K, Ishiyama K, Sakoe K, Nakamura M, Inokuchi J, Sanai Y & Saito M (1998) Expression cloning and functional characterization of human cDNA for ganglioside ... forward primer 5¢CGTCCCCACAATCGGTGTCA-3¢ and the reverse primer 5¢-ACCACTCCCTCTTTGACCAG-3¢; for GAPDH, the forward primer 5¢-CCACCCATGGCAAATTCCATGGCA -3¢ and the reverse primer 5¢-TCTAGACGGCAGGT...
- 12
- 303
- 0
Báo cáo khoa học: Mode of action of the microbial metabolite GE23077, a novel potent and selective inhibitor of bacterial RNA polymerase docx
Ngày tải lên :
30/03/2014, 15:20
... Selva, E (2004) Antibiotic GE23077, a new inhibitor of bacterial RNA polymerase I Taxonomy, isolation and characterization J Antibiot 57, 210–217 20 Plevani, P., Albertini, A. M., Galizzi, A. , Adamoli, ... minor damage to the cell membrane may have far-reaching consequences on cellular activities, and, in particular, on membrane-associated transport systems Although our data suggest that impairment ... isolated and its physico-chemical properties characterized as described previously [19] All other chemicals were purchased from standard commercial sources as analytical grade reagents RNAP assays...
- 9
- 339
- 0
Báo cáo khoa học: "Acute toxicity of second generation HIV protease-inhibitors in combination with radiotherapy: a retrospective case series" pptx
Ngày tải lên :
09/08/2014, 09:20
... chronological order of FDA approval, saquinavir, ritonavir, indinavir, nelfinavir, lopinavir, atazanavir, fosamprenavir (pro-drug of amprenavir, which is no longer available), tipranavir, and darunavir ... associated with HIV or AIDS (ductal carcinoma of the breast, renal cell carcinoma, cholangiocarcinoma, and meningioma), and two non-malignancies (dural AVM, and keloid scar) that were treated ... Shoemaker RH, Best CJM, Abu-Asab MS, Borojerdi J, Warfel NA, Gardner ER, Danish M, et al: Nelfinavir, a lead HIV protease inhibitor, is a broad-spectrum, anticancer agent that induces endoplasmic...
- 8
- 357
- 0
Báo cáo y học: "Pre-clinical development as microbicide of zinc tetra-ascorbo-camphorate, a novel terpenoid derivative: Potent in vitro inhibitory activity against both R5- and X4-tropic HIV-1 strains without significant in vivo mucosal toxicity" docx
Ngày tải lên :
10/08/2014, 05:21
... Veterinary Medical Association Panel on Euthanasia The vaginal tracts were surgically excised and parts of the upper (cervicovagina), middle (midvagina), and lower (urovagina) areas of each vagina ... pharmacological activities, such as antimalarial and anti-inflammatory activities[7] BA and its derivatives have demonstrated high anti-HIV-1 activity and cytotoxicity against a variety of tumor ... of "unacceptable" Formulations with vaginal irritation ratings between and are considered acceptable for vaginal application [16] Statistical analysis Statistical significance of the treated group...
- 11
- 480
- 0