major principles in a minor context forensic practices involving adolescents

Applications of Calorimetry in a Wide Context - Differential Scanning Calorimetry, Isothermal Titration Calorimetry and Microcalorimetry docx

Applications of Calorimetry in a Wide Context - Differential Scanning Calorimetry, Isothermal Titration Calorimetry and Microcalorimetry docx

... Ruiz-Sanz, Diana Romanini, Mauricio Javier Braia, Mar a Cecilia Porfiri, Ruel E McKnight, Stefka G Taneva, Sonia Bañuelos, Mar a A Urbaneja, Amal A Elkordy, Robert T Forbes, Brian W Barry, Laura ... crystals The Tg value after an annealing treatment can be taken as an indicator for the occurred changes in an amorphous/crystal ratio but also in PLA/filler interaction level The increase of an interfacial ... Gries, Eliane Lopes Rosado, Vanessa Chaia Kaippert, Roberta Santiago de Brito, R F B Gonçalves, J A F F Rocco, K Iha, Kazu-masa Yamada, Daniel Plano, Juan Antonio Palop, Carmen Sanmartín, Jindřich...

Ngày tải lên: 06/03/2014, 22:20

484 3K 0
Báo cáo khoa học: "Adaptation of Statistical Machine Translation Model for Cross-Lingual Information Retrieval in a Service Context" ppt

Báo cáo khoa học: "Adaptation of Statistical Machine Translation Model for Cross-Lingual Information Retrieval in a Service Context" ppt

... Anoop Sarkar, Kenji Yamada, Alex Fraser, Shankar Kumar, Libin Shen, David Smith, Katherine Eng, Viren Jain, Zhen Jin, and Dragomir Radev 2003 Syntax for Statistical Machine Translation: Final report ... and Maria Giagkou 2011 Towards using web-crawled data for domain adaptation in statistical machine translation In Proceedings of the 15th Annual Conference of the European Associtation for Machine ... 28–35, Barcelona, Spain Taro Watanabe, Jun Suzuki, Hajime Tsukada, and Hideki Isozaki 2007 Online large-margin training for statistical machine translation In Proceedings of the 2007 Joint Conference...

Ngày tải lên: 24/03/2014, 03:20

11 367 0
Báo cáo khoa học: "Temporal Connectives in a Discourse Context" ppt

Báo cáo khoa học: "Temporal Connectives in a Discourse Context" ppt

... subordinate clause has no special rhetorical role in a discourse, but acts instead as a temporal adverb Such instances are less problematic for classical approaches than cases like (1,2b), but at ... third stage of processing, as with (2b), both binding and accommodating V to a fail, and so we assume (1",6, 7) The laws that apply are: Narration, States Overlap and the Charm Law The Charm Law is ... S ~¢ V can't bind to the context, and so we assume (a, a, 7), and the laws that apply are: Narration and States Overlap But inferring Background via the Cascaded Penguin ({es,ts}, { charm(., ~,...

Ngày tải lên: 24/03/2014, 05:21

9 367 0
early adulthood in a family context [electronic resource]

early adulthood in a family context [electronic resource]

... welfare, but is instead about both making and maintaining positive, healthy, reciprocal relationships A mature perspective on relationships also demands that individuals accept the obligations and ... limitations, and interests; identifying available options and ways to take advantage of them; and, most importantly, being able to set goals that are a good and realistic match to abilities – but also having ... ordering in terms of early adult indicators of economic well-being and health by the age of 31 and 32 We examined college graduation, earnings, savings, and financial difficulties as well as physical...

Ngày tải lên: 29/05/2014, 15:46

282 346 0
POST TRAUMATIC STRESS DISORDERS IN A GLOBAL CONTEXT pot

POST TRAUMATIC STRESS DISORDERS IN A GLOBAL CONTEXT pot

... Quantitative Studies Paul Norman, Meaghan L O’Donnell, Mark Creamer and Jane Barton Part Chapter 13 Stress Management Training 211 247 269 The Potential of Stress Management Training as a Coping ... atomic bombings of Hiroshima and Nagasaki, natural disasters (such as earthquakes, hurricanes, and volcano eruptions) and human-made disasters (such as factory explosions, airplane crashes, and ... University Faculty of Medicine, Northern Uganda, Gulu, Uganda XI Part Overview of Clinical Aspects Post Traumatic Stress Disorder – An Overview Amarendra Narayan Prasad Ministry of Defence (Indian Army),...

Ngày tải lên: 27/06/2014, 15:20

298 286 0
báo cáo khoa học: "A statistical model for genotype determination at a major locus in a progeny test design" ppt

báo cáo khoa học: "A statistical model for genotype determination at a major locus in a progeny test design" ppt

... identification of genotypes in the case of the Booroola major gene, we suggest a general approach for determining the genotype at a major locus in a progeny test design, in the case of a quantitative ... estimations of the parameters is defined in another way and calculate at each step the probability p, We, u) can be used in have to now, have : The we and probabilities ,n, We shall have a are ... polygenic variability of the ovulation rate is a bias source already shown by Dnvts et al (1982 a) For example, an FF ram may have a very low breeding value for ovulation rate (compared to the mean of...

Ngày tải lên: 09/08/2014, 22:22

16 364 0
Báo cáo sinh học: "Comparison of four statistical methods for detection of a major gene in a progeny test design" pptx

Báo cáo sinh học: "Comparison of four statistical methods for detection of a major gene in a progeny test design" pptx

... to the assumed polygenic variation When two alleles A and a are segregating at a major locus, three genotypes are possible (AA, Aa, aa) which we shall respectively denote 1, 2, Sires are of genotype ... per dam Sires and dams are assumed to be unrelated Only offspring are measured, with one datum per animal ;j ’ are according to a sample consists of n sire families (i one offspring = Models and ... genotype and normally distributed with a mean and a variance U u ij E is the residual random effect, assumed to be independent of the genotype t and normally distribued with a mean and a variance...

Ngày tải lên: 14/08/2014, 20:20

17 352 0
Báo cáo y học: "Analysis of gene expression in a developmental context emphasizes distinct biological leitmotifs in human cancers" pdf

Báo cáo y học: "Analysis of gene expression in a developmental context emphasizes distinct biological leitmotifs in human cancers" pdf

... represents 46% of all datasets and contains tumors from a diversity of anatomical locations, including lung carcinomas, bladder cancers, hepatocellular carcinomas and the hematological malignancy T-cell ... healing program might be effective against both ovarian and renal carcinoma, but not against Wilms' tumor or lung adenocarcinoma Interestingly, a recent paper that examined gene expression in ... guidance and participated in the preparation of the manuscript CJB, AP, KF and KN performed the experimental work Additional data files The following additional data are available Additional data...

Ngày tải lên: 14/08/2014, 20:22

19 298 0
Contemporary Issues of the Semiotics of Law  Cultural and Symbolic Analyses of Law in a Global Context  O nati International Series in Law and Society

Contemporary Issues of the Semiotics of Law Cultural and Symbolic Analyses of Law in a Global Context O nati International Series in Law and Society

... Brisbane, Australia She was educated in China and Australia in interpreting and translation, linguistics, and law She has published in the areas of translation theory, Chinese legal translation and ... Imperial Australia-New Zealand Army Corps at Gallipoli, as a defining national moment, an important part of a heritage to be shared by all who wish to be considered truly Australian In mining company ... writes about a garden of forking paths.1 This is a story that can be read in different ways It can be read as a detective novel, in which the reader is accompanying the main character in a murder investigation...

Ngày tải lên: 13/10/2016, 11:23

287 719 0
Tài liệu Managing Telecom Invoices & Service Contracts in the Enterprise:A Guide to Best Practices doc

Tài liệu Managing Telecom Invoices & Service Contracts in the Enterprise:A Guide to Best Practices doc

... require detailed examination to glean specific details enabling contractual validation To aid the validation process, a contract inventory allows customers to extract specifics about each validation ... environmental and service changes Validating financial accuracy is supported with invoice and contract inventories, as they contribute to the validation points of what is invoiced and what should be invoiced ... With each change, a financial impact is realized and the opportunity for changes to create invoice inaccuracy rises Validating the expected cost of change is an additional activity within the...

Ngày tải lên: 21/12/2013, 06:18

4 473 0
Tài liệu Managing Telecom Invoices & Service Contracts in the Enterprise:A Guide to Best Practices docx

Tài liệu Managing Telecom Invoices & Service Contracts in the Enterprise:A Guide to Best Practices docx

... require detailed examination to glean specific details enabling contractual validation To aid the validation process, a contract inventory allows customers to extract specifics about each validation ... environmental and service changes Validating financial accuracy is supported with invoice and contract inventories, as they contribute to the validation points of what is invoiced and what should be invoiced ... With each change, a financial impact is realized and the opportunity for changes to create invoice inaccuracy rises Validating the expected cost of change is an additional activity within the...

Ngày tải lên: 24/01/2014, 09:20

4 413 0
Tài liệu Báo cáo khoa học: Molecular cloning, recombinant expression and IgE-binding epitope of x-5 gliadin, a major allergen in wheat-dependent exercise-induced anaphylaxis ppt

Tài liệu Báo cáo khoa học: Molecular cloning, recombinant expression and IgE-binding epitope of x-5 gliadin, a major allergen in wheat-dependent exercise-induced anaphylaxis ppt

... 5¢-AAGTGAGCAATAGTAAACACAAATCAAAC-3¢ and 5¢-CGTTACATTATGCTCCATTGACTAACAACGA TG-3¢, were constructed based on fragment DNA sequences of the x-5 gliadin gene (GenBank accession numbers BE590673 and BQ245835) ... (5¢-ATTTCATATGCAACAACAATTCCCCCAGC AACAATCA-3¢) and antisense (5¢-TCTCGGATCCTCA TAGGCCACTGATACTTATAACGTCGCTCCC-3¢) oligonucleotide primers having an initiation codon and an NdeI site at the 5¢- and a BamHI site at the 3¢-adjacent ... using KOD DNA polymerase (Toyobo, Osaka, Japan) and DNA AMPLIFIER MIR-D40 (Sanyo, Osaka, Japan) To amplify the DNA fragments containing a complete x-5 gliadin gene, oligonucleotides, 5¢-AAGTGAGCAATAGTAAACACAAATCAAAC-3¢...

Ngày tải lên: 20/02/2014, 01:20

8 484 0
Pulmonary Tuberculosis: Knowledge, Attitudes and Practices of Selected Physicians in a Tertiary-Care Hospital docx

Pulmonary Tuberculosis: Knowledge, Attitudes and Practices of Selected Physicians in a Tertiary-Care Hospital docx

... Physicians in a Tertiary Care Hospital Doctor’s Initials: Age: Sex: Specialty: male female General Practitioner Pulmonary Internal Medicine Infectious Disease Year graduated from Medical School: ... consisting of rifampicin, isoniazid and pyrazinamide The duration of treatment usually lasts 6-8 months [(n=36; 95%) (Table 5)] Table Physicians’ approach in the diagnosis of PTB Yes CXR alone ... exam for smear-positive cases are followed by 89.7% (n=35) Knowledge or information on tuberculosis is gained mainly through periodicals and attending academic meetings The internet is also a...

Ngày tải lên: 15/03/2014, 03:20

10 517 1
Báo cáo khóa học: Vertical-scanning mutagenesis of amino acids in a model N-myristoylation motif reveals the major amino-terminal sequence requirements for protein N-myristoylation ppt

Báo cáo khóa học: Vertical-scanning mutagenesis of amino acids in a model N-myristoylation motif reveals the major amino-terminal sequence requirements for protein N-myristoylation ppt

... GCCGGGATCCATGGGCAAAACGCTGAGCAAAGAGGACAAGCTCGAG GCCGGGATCCATGGGCAAGCAGAATAGCGCACTGCGGCCAGACAAG GCCGGGATCCATGGGCAAGGCAGCATCTGCAGCAGCAGCAGACAAGCCTGTAGCC GCCGGGATCCATGGGCAAGGCAGCATCTAAGGCAGCAGCAGACAAGCCTGTAGCC AATTAACCCTCACTAAAGGG ... ATATGGATCCATGGCTGCGGCAGCAGCGGCAGCAGCAGCAGACAAGCCTGTAGCC ATATGGATCCATGGGCGCGGCAGCAGCGGCAGCAGCAGCAGACAAGCCTGTAGCC GCCGGGATCCATGGGCGCAGCAGCATCTGCAGCAGCAGCAGACAAGCCTGTAGCC GCCGGGATCCATGGGCGCAGCAGCANNKGCAGCAGCAGCAGAC ATATGGATCCATGGGCNNKGCAGCAGCGGCAGCAGCAGCAGAC ... ATATGGATCCATGGGCNNKGCAGCAGCGGCAGCAGCAGCAGAC GCCGCTCGAGCCTGTAGCCCATGTT AATTCTCGAGTGCTGCTGCTGCCGATGCTGC AATTCTCGAGTGCTGCTGCTGCCGTTGCTGC AATTCTCGAGTGCTGCTGCTGCGAATGCTGC GCCGGGATCCATGGGCAAAACGCTGAGCAAAGAGGACAAGCTCGAG...

Ngày tải lên: 16/03/2014, 16:20

12 512 0
Báo cáo khoa học: Netropsin interactions in the minor groove of d(GGCCAATTGG) studied by a combination of resolution enhancement and ab initio calculations pot

Báo cáo khoa học: Netropsin interactions in the minor groove of d(GGCCAATTGG) studied by a combination of resolution enhancement and ab initio calculations pot

... both a planar and a nonplanar guanine G9 amino group The HF interaction component in the planar guanine amino group was computed to be 55 kJÆmol)1 (40 kJÆmol)1 in the nonplanar guanine amino group), ... which nine contain A and T bases in the central part of the DNA (seven contain an AATT tract and two contain a mixed ATAT tract) Only three structures, GDLB31 [9], GDL014 [11] and GDJ046 [12], are ... Acta Cryst D51, 190–198 Abrescia NGA, Malinina L & Subirana JA (1999) Stacking interaction of guanine with netropsin in the minor groove of d(CGTATATACG)2 J Mol Biol 294, 657–666 Chen X, Mitra...

Ngày tải lên: 16/03/2014, 22:20

11 484 0
Báo cáo khoa học: "A Probabilistic Context-free Grammar for Disambiguation in Morphological Parsing" pdf

Báo cáo khoa học: "A Probabilistic Context-free Grammar for Disambiguation in Morphological Parsing" pdf

... each categorial level has a phonological level associated with it As we are mainly interested in the morphological aspects, we leave the phonological claims for what they are: within SPRAAKMAKER, ... the training set: for one thing, it must have a reasonable size and be representative of the domain that is being modelled Our training set was the CELEX database which contains approximately ... a production rule is going to appear anywhere in a sample of the language, and production rules are not always context- free [Magerman and [van den Bosch and Daelemans, 1993] A van den Bosch and...

Ngày tải lên: 18/03/2014, 02:20

10 435 0
HealtH education PrinciPles in Patient education: A literature review of selected health education principles used in patient education pdf

HealtH education PrinciPles in Patient education: A literature review of selected health education principles used in patient education pdf

... task The challenges in this area are thus: To create coherence and integration in a multifaceted intervention so that individual parts interact To establish an overall educational approach and ... suggest that cognitive and behavioural strategies as part of self-management programs would be useful for motivating and maintaining compliance to a regular walking program among moderate to severe ... multifaceting? Individual and context in patient educa- tion – What health education outcomes are there for differing types of individual and contextual focus in patient education? Participation and motivation...

Ngày tải lên: 22/03/2014, 15:20

67 326 0
Báo cáo khoa học: Lack of stabilized microtubules as a result of the absence of major maps in CAD cells does not preclude neurite formation pot

Báo cáo khoa học: Lack of stabilized microtubules as a result of the absence of major maps in CAD cells does not preclude neurite formation pot

... GTTGGTCTCGTCGCTCATCACATCACGAGG GCTTGAAGGCGCTGGATCTGCGACAATAG GACTGGGCTTTCATCAGCGACAGGTGGC GTGAACCACCAAAATCGGAGAACGAAGC CAGGTTCTCAGTAGAGCCAATCTTCGACCTGAC AGAGTCGGATGCAGTTGCCCGGGCAACA GGCTCCTCCAGCACCCTCCGGGTCCCG ... GGCTCCTCCAGCACCCTCCGGGTCCCG CCCCAAACTTGTGACCATCATTC GGAGAAATCATCTTGAGCATAGCG CGAACTCTCAAGGGC ATGCATCAGAACCATGCACG AGCCCTACAATTCCATCCTCACC GCTGAAGGAGACGATGAGGGTGA 82898–82923 83581–83552 91489–91517 ... simultaneously with antitubulin (DM 1A) and anti-actin (lanes and 2) Other samples were stained with antineurofilament protein (lanes and 4) The volume of each sample was adjusted to load a similar amount...

Ngày tải lên: 23/03/2014, 05:22

14 416 0
A survey of technology thinkers and stakeholders shows they believe the internet will continue to spread in a “flattening” and improving world. There are many, though, who think major problems will accompany technology advances by 2020 doc

A survey of technology thinkers and stakeholders shows they believe the internet will continue to spread in a “flattening” and improving world. There are many, though, who think major problems will accompany technology advances by 2020 doc

... early 1990s predictions are available in a searchable database online at the site Imagining the Internet: A History and Forecast and they are also the basis for a book by Anderson titled Imagining ... southeast Alaska has been preserved in an online database used by schoolchildren in Glacier Bay More places are seeing the development of indigenouslanguage projects and databases online Broadband ... only a fraction of what it will be in 15 years Data mining of personal traces is in its infancy Automatic facial recognition of video images is in its infancy Surveillance cameras are not all...

Ngày tải lên: 29/03/2014, 19:20

115 441 0
w