maintenance of a stable internal environment in humans

... Randomization Selected variant (FLAG-positive) TAC Y GGG G NNS X TAC Y AAG K CTG L NNS X AAG K GAT D GAT D GAT D GAT D GAC D GAC D GAC D GAC D GAT D GCG A NNS X GAT D GAT D GAT D GAT D CGA R AAG ... acquiring SPR data for FLAG-PRAI and trPRAI binding to mAb M2, it became apparent that the latter displayed increased binding at any given concentration (Fig 6) Affinities for the antibody were quantified ... Molecular dissection of the folding mechanism of the a subunit of tryptophan synthase: an amino-terminal autonomous folding unit controls several rate-limiting steps in the folding of a single domain...

Ngày tải lên: 30/03/2014, 20:20

... collaboration We also thank Hans Aniansson for carrying out the neuropsychological examinations, Sara and Lisa Broeren for drawing velocity and acceleration profiles and Ragnar Pascher for programming ... straight line distance required to obtain a hand path ratio (HPR) Thus, a hand trajectory that followed a straight line pathway to the target would have an HPR equal to 1, whereas a hand trajectory ... sessions and All participants were tested between 10 AM and PM All tests were performed with the right hand Data analysis Kinematic data sampling and information processing Hand position data (haptic...

Ngày tải lên: 19/06/2014, 10:20

... release, a sample of native flies was taken to determine the allelic frequencies in the natural population Another sample was taken at the end of release During the following weeks, new bananas ... electrophoresis and ADH activity was stained by the usual procedure, using isopropanol as a substrate II1 Results About 000 gcnitically-marked adults were released over a week in the close of the banana baits ... 588-590 adaptation OUIS -L CHEEMAECKER C., DE S M., 1977 Genetic latitudinal adaptation of Drosophila melanogaster : new discriminative biometrical traits between European and equatorial African populations...

Ngày tải lên: 09/08/2014, 22:23

... collaboration We also thank Hans Aniansson for carrying out the neuropsychological examinations, Sara and Lisa Broeren for drawing velocity and acceleration profiles and Ragnar Pascher for programming ... straight line distance required to obtain a hand path ratio (HPR) Thus, a hand trajectory that followed a straight line pathway to the target would have an HPR equal to 1, whereas a hand trajectory ... sessions and All participants were tested between 10 AM and PM All tests were performed with the right hand Data analysis Kinematic data sampling and information processing Hand position data (haptic...

Ngày tải lên: 11/08/2014, 14:20

... response was defined a ≥ 20% Kaplan Meier (KM) Analysis of olanzapine versus quetiapine for days in patientsresponse, a ≥ 20% improvement over baseline as Kaplan Meier (KM) Analysis of olanzapine versus ... favoring olanzapine against all comparators except aripiprazole In one of the two studies in which ziprasidone was the comparator, patients treated with olanzapine spent a higher proportion of ... within the Eli Lilly and Company Clinical Trial Database, met inclusion criteria, including trial each comparing olanzapine to risperidone [13], quetiapine [14], and aripiprazole [15], and trials...

Ngày tải lên: 11/08/2014, 16:23

... enumerating and paying taxation as well as performing other financial obligations in accordance with the prevailing laws - Ensuring product quality in line with the registered standards, and offering ... parties are familiar with available insurance policies, but it is too strict and necessary for an international transaction Unless parties are assured that the coverage is available in the amount ... it had to face numerous obstacles both internally and externally In terms of internal conditions, the Company was somewhat in the shortage of capital that required it manage to mobilize capital...

Ngày tải lên: 18/04/2013, 08:57

... graduate Thermodynamics in the Department of Mechanical Engineering at UFRJ He is a member of the Brazilian Society of Mechanical Sciences and Engineering (ABCM) and of the American Institute of ... the beginning of each iteration is performed The analysis provides information to hierarchically classify the components as main, secondary, and remainder, and to define main decision variables ... Valero A Exergy accounting: Capabilities and drawbacks Energy 2006, 31(1), 164-180 Giannantoni C., Lazzaretto A. , Macor A. , Mirandola A. , Stoppato A. , Tonon S., Ulgiati S Multicriteria approach...

Ngày tải lên: 05/09/2013, 16:30

... research approaches to support the small-scale household farming in utilizing and managing of agricultural and natural resources reasonably Central elements in this participatory research are team-work ... multi-disciplinary team-work and also multiple perspectives It gives the appreciative character of social organization of innovation In fact that SWG acts to bring a collaborative and linking among ... objective of the FARM Program is to enhance the capabilities of GOs and NGOs, to build local capacity of resource poor farmers for sustainable use and management of agricultural and natural resources...

Ngày tải lên: 16/01/2014, 21:20

... PAGE analysis of the mitochondrial membranes isolated from all these deletion strains and from a wild-type strain In the DQCR9, DISP and DBCS1 strains, a protein band of approximately 500 kDa ... Results Molecular characterization of a 500 kDa bc1 sub-complex in the yeast deletion strains lacking Qcr9p, ISP or Bcs1p BN ⁄ PAGE analysis of a yeast mutant strain in which the gene encoding the Qcr9p ... assistance of specific chaperone proteins is also required The available data indicate that the accessory factor Bcs1p is involved in the binding of ISP to an immature bc1 intermediate Yeast cytochrome...

Ngày tải lên: 18/02/2014, 08:20

... was prepared by incubating catechol with resting cells of a mutant, strain Y-2, of the aniline-assimilating Pseudomonas sp strain AW-2 [20] Results Spectral changes during metabolism of 4-amino-3hydroxybenzoic ... to any other sequences available in FASTA and BLAST database programs at the DNA Data Bank of Japan Recently, we reported the cloning and sequencing of the gene encoding 4-amino-3-hydroxybenzoate ... metacleavage pathway of 2-aminophenol in Pseudomonas sp strain AP-3 (A) Proposed pathway of 4-amino-3-hydroxybenzoic acid in Bordetella sp strain 10d (10) I, 4-amino-3hydroxybenzoic acid; II, 2-amino-5carboxymuconic...

Ngày tải lên: 19/02/2014, 16:20

... The anchoring of a- carboxylate and a- amino group in the external aldimine defines automatically the positions of the a- proton and the side chain of any bound amino acid The lability of the a- proton ... Braunstein, A. E (1947) Labilization of a- hydrogen of amino acids under the action of aminoferase Biokhimia 12, 556–568 (in Russian) Ó FEBS 2004 Esaki, N., Nakayuma, T., Sawada, S., Tanaka, H & Soda, K ... typical representatives of the two groups of amino acid inhibitors mentioned above The interaction of L-phenylalanine, L-methionine, and their a- deuterated analogs with TPL in D2O was characterized...

Ngày tải lên: 19/02/2014, 16:20

... charge of parabutoporin, this could explain the higher antibacterial activity on Gram-negative bacteria for parabutoporin compared to opistoporin Also with magainin analogs, an increase in antibacterial ... amino acids) [19], peptides consisting of amino acids 7–22 of parabutoporin (an a- helical part having the four amino acids LAKK identical to mastoparan) and of the first 28 amino acids of the ... Gramnegative and Gram-positive bacteria and their activity was compared with the activity of melittin and mastoparan (Table 1) Parabutoporin inhibits the growth of all Gram-negative bacteria...

Ngày tải lên: 21/02/2014, 15:20

... in uenzae LPS [16,18,40,41] The lic 3A gene, which has been shown to encode a sialyltransferase that adds Neu5Ac in an a- 2,3linkage to lactose in other H in uenzae strains, is present in strain ... Schweda, E.K.H (2001) A rapid and sensitive procedure for determination of 5-N-acetyl neuraminic acid in lipopolysaccharides of Haemophilus in uenzae: a survey of 24 nontypeable H in uenzae strains ... A- OH (O-deacylated lipid A) , 953.02 Relative abundance was estimated from the area of molecular ion peak relative to the total area (expressed as percentage) Peaks representing less than 3% of...

Ngày tải lên: 08/03/2014, 02:21

... Dynamics) after scanning of the autoradiogram In vitro transcription, translation, targeting and cross-linking analysis To generate truncated mRNA, plasmids encoding truncated nascent chains of FtsQ ... core of the signal sequence Tetracycline-resistant prlA+ and prlA4 Table Bacterial strains and plasmids used in this study Camr and Ampr indicate resistance to chloramphenicol and ampicillin, ... SecY-(G-10L)94PhoE adduct (Fig 2A, lanes and 5) probably results from the amino-acid substitutions in the mutant PrlA4 protein In the Na2CO3 supernatant, at least three major crosslinking adducts, of apparent...

Ngày tải lên: 08/03/2014, 09:20

... Abbreviations AAT Administrative Appeals Tribunal AD Action Directe [Direct Action] AFP Australian Federal Police AG Attorney-General AIC Australian intelligence community ANAO Australian National ... National Audit Office AQMI Al-Qaida pour le Maghreb Islamique [al Qaeda for the Islamic Maghreb] ASALA Armenian Secret Army for the Liberation of Armenia ASIO Australian Security Intelligence Organisation ... human sources A certain amount of data emanates from well-placed informants and individuals who submit plea bargains during trials for illegal activity While this particular form of human intelligence...

Ngày tải lên: 15/03/2014, 21:20

... database and search engine Mass determination of proteins was done with the same instrument operated in linear mode and externally calibrated with a mixture of proteins Protein determination and ... and bacterial, protease contamination Protein concentration was determined with a Bio-Rad protein assay kit using BSA as a standard according to the manufacturer’s protocol Any bacterial and protease ... USA) and the tryptic peptides were extracted and analysed in a Bruker Ultraflex MALDI TOF ⁄ TOF instrument using alpha-cyano-4-hydroxycinnaminic acid (Sigma) as matrix The instrument was calibrated...

Ngày tải lên: 16/03/2014, 04:20

... (5¢-gccgcccatatgcaccaccaccaccaccacagcaccagtca gaactct), the reverse primer xa100– (5¢-gtggtgaattcagc cagtgtgcccttg), and pNIall2 as a template To facilitate purification of recombinant enzyme, ... contains 808 amino acids with a calculated average molecular mass of 87 392 Da The total calculated average molecular mass of the heterotetrameric (a2 b2) protein is 290 298 Da Electrospray MS of ... (Qiagen Inc., Valencia, CA, USA) All DNA manipulations were carried out using standard protocols [24] LASERGENE software (DNAstar Inc., Madison, WI, USA) was used for sequence manipulation and assembly,...

Ngày tải lên: 16/03/2014, 23:20

... used as a template with the following primers : R450AUp (5¢-GACGAGTACACGGT GGCCGGATACAACCTCAGGA-3¢) and R450ALo (5¢-TC CTGAGGTTGTATCCGGCCACCGTGTACTCGTC-3¢); Y452AUp (5¢-ACACGGTGCGCGGAGCCAACCTCAAG ... visible in the electron density map and are not included in the final model Structural data are available in the Protein Data Bank database under the accession number 3NJT Overlay assay Channel analysis ... and FhaCY45 2A inserted in lipid bilayers were analysed in comparison with those of FhaCWT Initial characterization was performed by inserting a large number (about 100) of FhaC molecules in a...

Ngày tải lên: 23/03/2014, 03:20

... translation (see below), amyH was amplified using chromosomal DNA of H hispanica as template, and primers AmyH-T 7a (atatcatATGAATCGACCCCGAATTACC GGCAG) and AmyH-T7b (atataagcttGTCTCCGTGGCG TGCCAGCTTACTG), ... Quickchange mutagenesis were AmyKKfor (CCGGCAGTAAGCAGGCGTCTaagaaaACC GTTCTGAAAGGAATCG) and AmyKKrev (GGCCGTC ATTCGTCCGCAGAttctttTGGCAAGACTTTCCTTAGC) (bold letters indicate the nucleotides encoding ... the mutated residues) To construct pSY-AmyH, the amyH gene from H hispanica was amplified using pET-AmyH as template, with primers AmyFor-NdeI (TTTGTTTAACTTTAAGAAGG AGATATACATATGAATCG) and AmyRev-NcoI...

Ngày tải lên: 23/03/2014, 06:20

... GCCCGATGCCGACAGCA GCCCGATGCCGACAGCAGAATGGTTTCACGAACAAGACGTTTGGCAAAACCCTTTATACCAGCCTCCCTTGGGCA GCCCGATGCCGACAGCAGAATGGTTTCACGAACAAGACGTTTGGCAAAACCGAGTACTCCAAAACTAATCAATAT GGGAATTAATACGACTCACTATAGGNNNNNAAAAGTTATCAGGCATGCACCT ... GGGAATTAATACGACTCACTATAGGNNNNNAAAAGTTATCAGGCATGCACCT GGGAATTAATACGACTCACTATAGGNNNNNGATAGTCAGCATGTACGCTGGC GGGAATTAATACGACTCACTATAGGNNNNTAAAAGCAACTAGAAATAGCGT GGGAATTAATACGACTCACTATAGGNNNNAGGGGACCTTGCAAGTCCCCTA GCCCGATGCCGACAGCAGAATGGTTTCACGAACAAGACGTTTGGCAAAACCGGTATGCGCTTAGCCTTAGAC ... GCCCGATGCCGACAGCAGAATGGTTTCACGAACAAGACGTTTGGCAAAACCGGTATGCGCTTAGCCTTAGAC GCCCGATGCCGACAGCAGAATGGTTTCACGAACAAGACGTTTGGCAAAACCCTTTGTACCGACCTCCGCCAA CAGCAGAATGGTTTCACG CAGAAGCTCATCCGGCTG AGCATCACGACGCCGTCA...

Ngày tải lên: 23/03/2014, 11:20