m198 carries a point mutation in sec13 gene

... 2000) Gata1, Gata2 and Gata3 mainly involve in the hematopoiesis process while Gata4, Gata5 and Gata6 play similar roles as the Foxa proteins in endoderm organogenesis In mammals, Gata4, Gata5 and ... 1.3.2.2.2 Gata transcription factors The Gata family zinc finger transcription factors are named after their DNA binding sequence They have six known family members, Gata1 to Gata6 (Lowry and Atchley, ... earliest is anatomical approach, which gave rise to experimental approach Genetic approach was built based on anatomic and experimental approaches Recently, molecular genetics has begun to integrate...

Ngày tải lên: 14/09/2015, 12:11

... NADPH enhances de novo PrPSc propagation in PMCA PMCA-derived PrPSc maintains a stable propagating capacity in normal brain homogenates after NADPH is removed Because the increased level of NADPH-diaphorase ... of NADPH and PrPSc propagation was analysed We found that PrPSc propagation was gradually enhanced with increasing NADPH concentration (from 1.25 to 10 lm), and reached a plateau at 10 lm NADPH ... was also appropriate to another scrapie agent, hamsteradapted scrapie strain 13 9A (SHa-13 9A) was used in PMCA following the same procedure In order to avoid possible environmental contamination,...

Ngày tải lên: 07/03/2014, 03:20

... following mutagenic forward primers were used: Y28 6A, 5Â-GATCA TGAATTGTTTCTGTCGCCAGTAACCAGCTTGGCCC CAGGAGGAGACATAGGCG-3Â; LSYTRF, 5Â-GCAAG AAGAATTGTTTCTGTCGCCAGTGAACCGGGTATAT GACAAAGGAGACATAGGCGAGAGGGGAGC-3Â ... sorting signals, transmembrane sorting signals have been identied For example, the gastric H,K-ATPase has an apical sorting signal in its 4th transmembrane domain, although the exact amino acids responsible ... transferrin receptor internalization signal does not contain basolateral targeting information [48] Interestingly, gap junction plaques were found predominantly on the lateral membrane domain,...

Ngày tải lên: 23/03/2014, 04:20

... patients at three years, and for 77 patients at four years Demographic and clinical characteristics of these patients year after diagnosis are summarized in Table The mean age was 58 years, and ... joint space narrowing score over the following year (for example, a relative increase of 6.4% in the joint space narrowing score during the next year caused by a one standard deviation increase ... cPercentage increase in radiographic damage scores per year for patients with a value one standard deviation above the mean biomarker value year after disease onset come reflective of skeletal damage...

Ngày tải lên: 09/08/2014, 07:20

... Matsuura K, Sano M, Nishi J, Iwanaga K, Akazawa H, Kunieda T, Zhu W, Hasegawa H, Kunisada K, Nagai T, Nakaya H, Yamauchi-Takihara K, Komuro I: G-CSF prevents cardiac remodeling after myocardial ... Komada A, Takahashi T, Kosai K, Fujiwara T, Fujiwara H: Acceleration of the healing process and myocardial regeneration may be important as a mechanism of improvement of cardiac function and ... tirofiban treatment, implying a significant role of inflammation association in our model Simvastatin also ameliorates inflammatory stage in the heart tissue of I + G mice Heart tissue was sampled at...

Ngày tải lên: 10/08/2014, 05:21

... concentrated in central and northeast Thailand and along Viet Nam’s coastline; (ii) biomass potential is concentrated in the major rice-growing areas of the Chao Phraya basin, northeast Thailand, and ... 25% of additional savings in Thailand and Viet Nam were obtained from a recent study by ReEx Capital (2010) Each additional 25% block of savings was assumed to have a payback period years longer ... The findings and recommendations are by no means exhaustive and final, but are meant to serve as a springboard for more in- depth SEA on individual national PDPs The monetization of more indicators,...

Ngày tải lên: 08/09/2015, 23:32

... Message Public Speaking • Many dread it • Basic skills can be learned to get message across • With application and good training anyone can be a fluent and confident speaker • A great asset you will ... without any formal training, • And without getting accurate feedback Supporting Materials • Slide-shows not the heart of the presenation • For backup, not a script Training in presentation skills ... interest and enthusiasm, • in a way that keeps the attention of your audience Presentation • Always about selling something • An idea • A different way of thinking Presentation tools Presentation...

Ngày tải lên: 27/06/2016, 10:30

... detection and parsing for transcribed speech In Proc of NAACL J Clarke and M Lapata 2008 Global inference for sentence compression: An integer linear programming approach Journal of Artificial Intelligence ... meeting corpus (Janin et al., 2003), which contains naturally occurring meetings, each about an hour long All the meetings have been transcribed and annotated with dialogue acts (DAs), topics, abstractive ... 2009 A global optimization framework for meeting summarization In Proc of ICASSP C Hori, S Furui, R Malkin, H Yu, and A Waibel 2003 A statistical approach to automatic speech summarization Journal...

Ngày tải lên: 23/03/2014, 17:20

... of minimal intervention with a dual strategy of decreasing lymph production and ensuring adequate protein intake to counter any effects of the potential hypoproteineamia As first line management, ... Williams WW, Adatia IA: Chylopericardium after cardiac operations in children Ann Thorac Surg 2001, 72:193-6 Shanmugam G, Sundar P, Shukla V, Korula RJ: Chylopericardium after atrial septal defect ... patient and avoids the potential complications of total parenteral nutrition It also has the added theoretical benefit of promoting normal gut flora and preventing translocation of pathogens in a patient...

Ngày tải lên: 10/08/2014, 10:20

... spead futures interest rate spead Biến credit spread xem báo tốt cho chu kỳ kinh doanh căng thẳng tài chính, thay đổi mức chênh lệch lãi suất (interest rate spread) hợp đồng tương lai báo độ dao ... biệt lớn => ECB có quan tâm đến điều kiện kinh tế trước đ a sách tiền tệ  Mô hình 11 Mô hình 12: sử dụng liệu thời gian thực thay liệu điều chỉnh cho hai biến inflation Output_gap  Mô hình 13 Mô ... tắc Taylor tuyến tính Vì NHTW không hướng tới lạm phát hay khứ mà hướng tới lạm phát kỳ vọng Clarida cộng (1998) đề xuất sử dụng quy tắc Taylor dạng forward-looking • E kỳ vọng • Ωt vector chứa...

Ngày tải lên: 21/06/2015, 23:44

... that rule can be augmented with a financial conditions index containing information from some asset prices and financial variables? COMPANY LOGO www.themegallery.com Theories Taylor rule Monetary ... (UK) AIM OF THIS PAPER augmented with a financial conditions index that captures the relevant eco- nomic information contained in some financial variables COMPANY LOGO www.themegallery.com INTRODUCTION ... investigated by Montagnoli and Napolitano (2005) They build and use a financial conditional indicator that includes the exchange rate, share prices and house prices in the estimation of a Taylor...

Ngày tải lên: 14/07/2015, 08:34

... output gap above and below the target • Asset prices • Financial variables • Central banks target Nonlinear rule Inflation and expected output gap instead of past Augmented with a financial conditions ... The asymmetric are accounted for by a separate analyst for inflation above and below the target Anser the question of whether a central bank follows a point target or a target rangr for inflation ... expected Inflation and Output gap instead of past or current value Extension 2: Augmented with a financial conditions index • Central Bank are targeting the revelant economic information contained in...

Ngày tải lên: 14/07/2015, 08:34

... kết mô hình kinh tế vĩ mô phi tuyến tính (Dolado et al., 2005), nonlinear central bank preferences (Dolado et al., 2000; Nobay and Peel, 2003; Ruge-Murcia, 2003 and Surico, 200 7a) or both (Surico, ... lọc Kalman thông qua công thức (9) dạng state-space: Trong đó, sai số xem nhiễu trắng độc lập với ma trận phương sai – hiệp phương sai cho Var(µt) = Q Var(ωt) = R, Var(µtωs) = với tất t s X ma trận ... credit spread xem báo tốt cho chu kỳ kinh doanh căng thẳng tài chính, thay đổi mức chênh lệch lãi suất (interest rate spread) hợp đồng tương lai báo độ dao động kì vọng từ thành phần kinh tế, ngân...

Ngày tải lên: 14/07/2015, 08:37

Ngày tải lên: 04/10/2012, 10:24

... in this analysis For other participants the average of the baseline and follow-up FFQ data were used in the analyses The average daily intake of individual food items (g/day) was combined to ... physical activity was obtained using a validated questionnaire [11] The questionnaire evaluated regular exercise and sports participation during the previous years and provided information on daily ... meat Processed meats included smoked meat/bacon, salted meat/preserved meat and Chinese sausage A structured questionnaire was used to collect information on participant characteristics such as...

Ngày tải lên: 31/10/2012, 16:49

... controversial and complicated issues that result in strained international trade relations, hinder WTO's target in establishing a transparent, equal international business environment 1.2 Anti-dumping ... capita, Brazil is classified in the same category as China, Thailand and Indonesia, not Vietnam Vietnam has to import cow leather and does not have the same access to raw materials as Brazil ... of establishing normal value for Vietnam The three main Brazilian exporting producers are: - Bison Indústria de Calcados Ltda - Calcados Azeleia SA - H Bettarello Curtidora e Calcados Ltda One...

Ngày tải lên: 04/04/2013, 16:17

... Analyzing expressions c Analyzing and reasoning Analyzing contrastively (across languages) Translating Transferring d Creating structure for Taking notes input and output Summarizing Highlighting ... organization, inferencing, summarizing, deducing, imaginary, transfer, and elaboration Socialaffective strategies are related with social mediating activity and transacting with others 8 According ... b Arranging and planning Finding out about language your learning learning Organizing Setting goals and objectives Identifying the purpose of language task (purposeful listening / reading/speaking/writing)...

Ngày tải lên: 05/04/2013, 15:56

... sending messages Reasoning deductively Analyzing expressions c Analyzing and reasoning Analyzing contrastively (across languages) Translating Transferring d Creating structure for Taking notes input ... organization, inferencing, summarizing, deducing, imaginary, transfer, and elaboration Socialaffective strategies are related with social mediating activity and transacting with others 8 According ... as a means of communication and interaction, management of affective demands, and monitoring of L2 performance O’Malley and Charmot (1990) analyzed learning strategies in parallel with language...

Ngày tải lên: 17/04/2013, 10:12

... activities are becoming popular in the context of international trade Eliminating fair competition to break into markets, dumping has turned into an obstacle against the trend of trade liberalization ... 2.3.1.2 Accounting Firms have on clear set of basic accounting records which are independently audited on line with International Accounting Standards (IAS) and are applied for all purposes As far as ... relations, hinder WTO's target in establishing a transparent, equal international business environment 1.2 Anti-dumping law Le Thanh Hai - A4 - BBE - K41 11 Graduation thesis As analyzed above, if...

Ngày tải lên: 27/07/2013, 08:50

... you speak faster/more slowly please?' 'Could you repeat that/say that again please?' can go on indefinitely! Say 'Could you listen to me please?' and get them to repeat, then stare at them as if ... too Grammar Drills can even be done to illustrate a grammar point Take countable and uncountable nouns Put the students in groups of four Call out a noun and nominate a group If it is uncountable ... show the meaning Put all the pieces of paper in a line on the desk Hold one up, say the word and get the class to repeat Do this with all the words Then point to a piece of paper and ask a student...

Ngày tải lên: 06/09/2013, 10:10