lawful interception of voip by netcentrex and gten ag

... comparison of band absorbance Absence of a sharp and convoluted spectral band around 3600–3000 cm)1 in the spectra of both chitosan and LMWC indicated the absence of free -OH groups and the involvement ... Infrared (IR) spectra of chitosan and LMWC Table Characteristics of chitosan and low-molecular weight chitosan (LMWC), and the percentage yield of the depolymerization products Percentage yield is dependent ... (moles/L) · volume of titrant (mL)/mass of sample (g) and the level of deacetylation was calculated by comparison between the number of free amino groups (per unit weight of the sample) and the equivalent...

Ngày tải lên: 19/02/2014, 12:20

... summarizes the results of our laccase oxidations of substrates 1–5, and the effect of the cosolvent and of the mediators on the amount of substrate metabolized by the enzyme (a) Laccase and laccase/HPI ... determination of laccase activity Fig Mechanisms of the O2-laccase-HPI (A) and O2-laccaseTEMPO (B) oxidation of substrates 1–5 (Fig 2) The activity of laccase was determined by following the rate of oxidation ... could be detected by LC-MS, even though the formation of small amounts of olefinic products is indicated by 1H-NMR spectra also in this case (Fig 4) There is no evidence of oxidation of the internal...

Ngày tải lên: 21/02/2014, 01:21

... Plot of the standard volume change of the 33-kDa protein in the presence of different concentration of NaCl (d) and sucrose (m) vs the reciprocal of the sucrose osmolarity In Fig 8, the standard ... Kinetics of the pressure-induced unfolding and refolding of the 33-kDa protein in the presence of 30% glycerol Other conditions as in Fig Table Relaxation time of unfolding and refolding of the ... Stabilization of 33-kDa protein of spinach PS II against pressure unfolding (Eur J Biochem 270) 1657 Fig The effect of sucrose (m), glycerol (j) and salt (d) on the standard volume change of the protein...

Ngày tải lên: 31/03/2014, 01:20

... vermiculite, losses of K, Fe and Mg) occurred only in the rhizosphere and was greater in pine rhizosphere than in beech rhizosphere, which could be explained by the greater amount of organic acids ... released into the rhizosphere by pine roots (Leyval, 1988) The inoculation of roots with L laccata increased Mg, Fe, Al and K mobilization from the mineral and losses of K in pine rhizosphere Under ... Comparison between the utilization of phosphorus from insoluble mineral phosphates by ectomycorrhizal fungi and rhizobacteria In: Physiological and Genetical Aspects of Mycorhizae (GianinazziPearson...

Ngày tải lên: 09/08/2014, 04:20

... deqi and beneficial or non-deqi and harmful Discussion Limitations The sample size of this study was small and the scope of this survey is narrow The exclusion of the timing of deqi assessment and ... distributed to licensed acupuncturists attending workshop seminars directed by Page of one of the co-authors (LL): 30 in Chicago (USA) and 20 in Shanghai (China) Questionnaires were also distributed to ... survey found that a small percentage of participants disagreed with the majority, Table Survey responses by country in respect of pain characteristics Summary of responses Dull pain Throbbing...

Ngày tải lên: 13/08/2014, 14:20

... 1: First rule of Lakoff‘s theory of politeness 18 Figure 2: Second rule of Lakoff‘s theory of politeness 19 Figure 3: Employment of apologizing strategies by English and Vietnamese ... Frequency of the use of apologizing categories by English and Vietnamese speakers across the first five situations 49 Table 5: Frequency of the use of apologizing categories by English and Vietnamese ... strategy of minimizing the degree of offense or interjecting; in general, all of respondents employ some main strategies like the expression of apology, acknowledgement of responsibility, offer of...

Ngày tải lên: 17/07/2015, 10:56

... of all scales Using J 48 algorithm in the present work A standard tree induced with c5.0 (or possibly ID3 or c4.5) consists of a number of branches, one root, a number of nodes and a number of ... 1351–1366 Application of SVM and PSVM for problem at hand and results Fig 14 shows the methodology adopted for classification of various conditions of gear box using SVM and PSVM For each condition ... processing and classification of the data for any meaningful surveillance of the condition of the system being monitored The flowchart in Fig explains the process of data acquisition and further...

Ngày tải lên: 04/04/2016, 22:44

... C-terminal of the primary sequence, and the 2134 Fig Comparison of affinity for SQAG between the clone-14 and unselected clone Binding strengths of clone-14 and unselected clone on SQAG molecule ... biotinylated SQAG did not immobilize on the control well Increase rate of recovery for control ¼ titer of SQAG immobilized well ⁄ titer of control well Table SPR analysis of the binding of SQAGs to the ... A molecular target of SQAGs A S Aoki et al A B Fig Inhibition of the microtuble depolymerization activity of MCAK184 by SQAG in vitro In all assays, 120 nM of MCAK, 1500 nM of paclitaxel stabilized...

Ngày tải lên: 19/02/2014, 17:20

Ngày tải lên: 04/10/2012, 10:02

... sensitivity of 80% and a specificity of 70% (AUC 0.8) with a cut-off value of less than 1.95 cm/s Poor agreement between VVI and TDI measurements have been previously demonstrated, and therefore ... assessment of global and regional myocardial function, and a differentiation between infarcted and non-infarcted segments Further research for the definition of cut-off values and technical standards ... digital storage of cardiac cycles was not completed, and if movement of the files was evoked by breathing excursions of the patient The mean picture frame rate (PFR) was 45±16 s-1 The average values...

Ngày tải lên: 25/10/2012, 11:15

... downstream of Busan area of Nakdong river basin Estrogenic activity and concentration of estrogenic substances in the Nakdong River basin Relative estrogenic activity of the main and branch stream of ... Journal of Water and Environment Technology, Vol.1, No.2, 2003 the mainstream, points in branch streams, water treatment plants, and sewage treatment plants one each from the upstream of Andong ... 20ml of dichloromethane and distilled water after filtration by a glass fiber filter (Whatman GF/B, previously rinsed with MeOH and dried) The SPE column was eluted by dichloromethane, and then...

Ngày tải lên: 05/09/2013, 08:40

... anaerobic mesophilic and thermophilic conditions, the variation of MO at concentration of 100, 200, 400, 600, 800 and 1,000mg·L-1 and RB4 at concentration of 100, 200, 300, 400, 500 and 600mg·L-1 supplemented ... period and measured for decrease in color by spectrophotometer at 470 and 598 nm for MO and RB4, respectively The extent of decolorization was represented as a percentage decolorization Effect of ... digested sludge The potential of digested sludge on MO and RB4 tested by variation of dye concentration was shown by the different extent of decolorizing efficiency of the tested dyes MO could...

Ngày tải lên: 05/09/2013, 09:38

... - Variations of reduction rate for (a) TOC, TN and TP, (b) Cr, Fe, Pb, and Zn, and diurnal variations of contact times during field test Table - Mean and standard deviation (SD) of the concentration ... SD: Standard deviation, CV: Coefficient of variation - 12 - Journal of Water and Environment Technology, Vol 7, No 1, 2009 The water qualities of inflow water (IN) and outflow water (OUT) of the ... percentage of the concentration difference at IN and OUT (IN – OUT) to that at IN The reduction rates of TOC and TN ranged from approximately 20% to 40% (approximately 24.7% and 29.0% on average,...

Ngày tải lên: 05/09/2013, 09:38

... conductivity and the transport of salts such as cations (Na+, Ca2+, Mg2+ and K+) and Cl- in a column were investigated by using a tensiometer and a four-electrode sensor, and the amounts of these ... 18 mm of the point of the current supply electrode and 12 mm of the point of the voltage measurement electrode while insulating the other parts, and measures the electric conductivity of the ... and were packed in an acrylic ring with an outer diameter of 60 mm, inner diameter of 50 mm, and height of 20 mm at a bulk density of 1.53 g/cm3 The acrylic rings were filled up to a height of...

Ngày tải lên: 05/09/2013, 09:38

... one group of the GAOs; and EUBmix probe (a mixture of GCTGCCTCCCGTAGGAGT, GCAGCCACCCGTAGGTGT, and GCTGCCACCCGTAGGTGT) (Daims et al., 1999) targetting at most Bacteria Probes PAOmix and GB were ... between and or The effect of pH on the anaerobic uptake of radio-labeled acetate by Candidatus ‘Accumulibacter phosphatis’ and Candidatus ‘Competibacter phosphatis’ was examined by MAR-FISH, and ... CCCTCTGCCAAACTCCAG, and GTTAGCTACGGCACTAAAAGG) (Crocetti et al., 2000) targeting at Candidatus ‘Accumulibacter phosphatis’, one of the PAOs; GB probe (CGATCCTCTAGCCCACT) (Kong et al., 2002) targetting at Candidatus...

Ngày tải lên: 05/09/2013, 09:38

... simultaneously to clarify and to compare the behavior among the coagulants and coagulant aid Table - Conditions of coagulants and coagulant aid in long-term MBR experiments Coagulants Runs Polysilicate ... conventional coagulants MATERIALS AND METHODS Preparation of coagulants and coagulant aids Sodium silicate (Na2SiO3, anhydrous) used as coagulant aid was diluted with distilled water and then neutralized ... Protein and carbohydrate concentrations in R7, R8 and R9 (Error bars show the standard deviation of 21 samples) CONCLUSIONS This paper investigated the effects of the coagulants and coagulant...

Ngày tải lên: 05/09/2013, 10:15

... Brunei Indonesia Malaysia The Philippines All land and water areas km inland from MHWM and areas inundated by tides any time of the year Administrative and selected environmental units District boundaries ... for land and sea resources and space by various stake holders that result in conflicts and the degradation of coastal ecosystems Further challenges to the coasts come from: (1) erosion and siltation ... Vout Sout dt Expanding this equation: dS dV +S = Â Vin Sin - Â Vout Sout dt dt where SVin and SVout represent all of the hydrographic inputs and outputs and Sin and Sout are salinity of those water...

Ngày tải lên: 27/10/2013, 14:15

... network and the new packet-based networks by the media gateway The call control is handled by a softswitch, and the features and services are handled by an application platform In reality, the softswitch ... products and services to make voice calls based on IP The prevalence of IP nodes and the abundant supply of better IP–based switches and routers continue to reduce the cost of providing VoIP • ... bearer platform/media gateway, and allow efficient execution of the softswitch and signaling gateway software Benefits also include cost savings and deployment and operation simplicity In the...

Ngày tải lên: 10/12/2013, 17:15

... manufacture in England Landowners drove thousands of peasants out of their lands , turning these lands into pastures , or "enclosures " for sheep There was no work for the peasants and many of them became ... madness by the loss at the same time of his daughter, a considerable amount of money and jewellery of real and 18 sentimental value He learns of Lorenzo's and Jessica's spending spree and is then ... revival of interest in the ancient culture of Greece and Rome "but also "the discovery of the world and humanbeings" More than that, it implies "the awakening of man's mind and capacity, of individual...

Ngày tải lên: 18/12/2013, 21:45