l of a diffuse reflecting surface

... has an out -of- balance current of 50 A and larger load of 500 A The balancer set has a loss of 375 W in each machine Calculate the current in each of the balancer machines and output of main generator ... Underground Cables—Insulation Resistance of a Single-core Cable—Capacitance and Dielectric Stress— Capacitance of 3-core Belted Cables—Tests for Three-phase Cable Capacitance A. C Distribution Calculations—Load ... Industrial Applications of Electric Motors Advantages of Electric Drive—Classification of Electric Drives —Advantages of Individual Drive—Selection of a Motor—Electrical Characteristics —Types of...

Ngày tải lên: 26/11/2014, 11:10

... [11] L Jin and M Ru,Algebraic curves and the Gauss map of algebraic minimal surfaces, Differential Geom Appl., 25 (2007), 701-712 [12] Y Kawakami, R Kobayashi, and R Miyaoka, The Gauss map of pseudoalgebraic ... whether we may show a relation between of the ramification of the Gauss map and the total curvature of a complete minimal surface The main purpose of this article is to give an affirmative answer ... Dethloff and P H Ha, Ramification of the Gauss map of complete minimal surfaces in R3 and R4 on annular ends, Ann Fac Sci Toulouse Math., 23 (2014), 829-846 RAMIFICATION OF THE GAUSS MAP AND...

Ngày tải lên: 14/10/2015, 07:57

... to assess IFN-I levels rapidly and reliably in clinical samples and may be well suited to monitoring disease activity and response to therapy Materials and methods Patients and controls SLE patients ... GCC AGA CAA ACC TC-3', reverse 5'-TTC CAG CTG TGA CAC CTC AG-3'; CD32 forward 5'-TTC AAG GCC AAC AAC AAT GA-3', reverse 5'-GGA GAA GGT GGG ATC CAA AT-3'; CD64 forward 5'-GTG TCA TGC GTG GAA GGA ... Disease We thank Marlene Sarmiento, Annie Chan, and UF GCRC staff for assistance with clinical data collection and Ed Butfiloski for technical assistance Author Details 1Division of Rheumatology...

Ngày tải lên: 12/08/2014, 12:20

... Nomura, A. , Kawasaki, K., Kubo, T & Natori, S (1992) Purification and localization of p10, a novel protein that increases in nymphal regenerating legs of Periplaneta americana (American cockroach) ... cDNA sequence with that of the N-terminal sequence of the natural ASP3c protein [20] showed that a 21-residue N-terminal signal sequence is cleaved after translation The average molar mass calculated ... Pichia pastoris Lane shows standards (Low range and Polypeptide kits, Bio-Rad, France) and lanes 2–5 are 50-lL aliquots of 0–3-days culture supernatants Proteins were visualized by Serva blue...

Ngày tải lên: 21/02/2014, 03:20

... figures, Cahill et al (2007) show that a log-linear model based on structural features and a language model score performs considerably better realisation ranking than just a language model In our ... based on automatic evaluation metrics published in that paper are confirmed in an evaluation by humans Another goal is to collect data that will allow us and other researchers1 to explore ... would affect the evaluation results for the strings selected as most probable by the log-linear model ranker in any way Table summarises the results of Task 3a It shows that, at least overall,...

Ngày tải lên: 22/02/2014, 02:20

... 5¢-TCAGCGTCACCGTTATCCTC-3¢ 5¢-GTGAGAAATGGAGATGCTGC-3¢ 5¢-TGTTCCGGAGAGCCTCCTC-3¢ 5¢-CAACGGAAGCACGCATAGGAGCAC-3¢ 5¢-CACCGCATGCATAACTCTAGCTCCTTCTCTTG-3¢ 5¢-GTAAAACGACGGCCAGT-3¢ Ó FEBS 2002 4-Coumarate:CoA ligase ... 5¢-TCYGGRTCRTTNAGRTADCCTTTCAT-3¢ 5¢-TBACNCARTCNGCNTAYGTBGARAA-3¢ 5¢-GTTCTAAGCTTTTAAGGCGTCTGAGTGGC-3¢ 5¢-AGTTTCAGGGTCAACAACCCTG-3¢ 5¢-CTCGAATTCATGACAACGGTAGCTGCTTCTC-3¢ 5¢-CTCGGATCCATGGCTGATGATGGAAGCAG-3¢ 5¢-TCAGCGTCACCGTTATCCTC-3¢ ... cDNA [20] Fusion of partial Gm4CL3 cDNA and 5¢-end fragment amplified by PCR Full-length Gm4CL3 cDNA Full-length Gm4CL3 cDNA Partial Gm4CL4 cDNA [20] Fusion of partial Gm4CL4 cDNA and 5¢-end fragment...

Ngày tải lên: 22/02/2014, 04:20

... CLAP_1:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT CLAP_2:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT ... CLAP_2:ATTAGTGCTATAGTTTGGGAAATATTTAGTCCTTGTTTTGTGTGATCTTATAAGATAATATTTGTAGTTTGTGCTTTTATATAATTTAGCTCATTGGATT 1730 * 1888 CLAP_1:AAGATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTTCTAGATACGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA CLAP_2:AAGATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTTCTAGATACGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA (A) 48 ... CLAP_1:ATTTAAAAGAATTCCCGAATGGGCCAAGGATCTTCCATTGAAAGAAGTTTTGAGGTATCACATTGCAAGAGGGTTGTATTATGATAAAGATCTCCAGAAT CLAP_2:ATTTAAAAGAATTCCCGAATGGGCCAAGGATCTTCCATTGAAAGAAGTTTTGAGGTATCACATTGCAAGAGGGTTGTATTATGATAAAGATCTCCAGAAT...

Ngày tải lên: 07/03/2014, 16:20

... DEAE-Cellulose (diethylaminoethyl-cellulose) (Whatman) packed and equilibrated with the buffer A; the elution was performed with 200 mL of a 0–0.5 M linear gradient of NaCl in buffer A, at a ... 3, and acetonitrile (6 : 1, v/v); separation was performed isocratically, at a flow rate of mLÆmin)1, and the volume of injected samples was 10 lL The amounts of the residual initial phenolic ... [12], plus 50 mg L) 1 ascorbic acid, 30 g L) 1 sucrose, lmol L) 1 2,4-dichlorophenoxyacetic acid, lmol L) 1 3-indolylacetic acid (IAA), 0.2 lmol L) 1 benzylaminopurine, 8.0 g L) 1 Difco Bacto agar, pH...

Ngày tải lên: 08/03/2014, 08:20

... acids, including l- aspartate, l- glutamine, l- alanine, l- arginine, l- cysteine, l- proline, l- phenylalanine, l- lysine, l- tryptophan, l- isoleucine, l- tyrosine, l- histidine, l- leucine, l- valine, l- methionine, ... reaction was analyzed using primary alcohols (methanol to dodecanol, C1–C12), secondary alcohols (propan-2-ol to decan-2-ol, C3–C10), alcohols containing more than one hydroxy group and l- amino ... SDS ⁄ PAGE reveals a molecular subunit mass of  40 kDa, which is in fair agreement with the molecular mass (38 kDa) calculated from the amino-acid sequence The molecular mass of the native Pf-TDH...

Ngày tải lên: 16/03/2014, 14:20

... 552–556 Gallagher, S.C., Callaghan, A. J., Zhao, J., Dalton, H & Trewhella, J (1999) Global conformational changes control the reactivity of methane monooxygenase Biochemistry 38, 6752–6760 Wallar, ... KCl Ag/AgCl electrode (equivalent to approximately )520 mV relative to the SCE) was applied to all electrodes The counter electrode was a platinum mesh and a silver wire was used a reference Each ... previously [7,14] The regulatory protein used in all experiments was a catalytically active mutant with increased stability, in which glycine 13 was replaced by a glutamine Expression in Escherichia...

Ngày tải lên: 17/03/2014, 09:20

... outputs of port and port But now look closer at the scattering matrix We also note that the ports and of this device are matched It looks a lot like a lossless 3dB divider, only with an additional ... amplifying coefficient even more We have also investigated the S11 factor of the power divider Wilkinson on network analyzer, the result was relatively similar to that of the simulink model Afterthat ... fabricated the 200W amplifier modules from the smaller ones The basic modules were designed by using the microtrip technology [4], which are small and portable (figure 4a) After simulink modelling,...

Ngày tải lên: 22/03/2014, 11:20

... initial mean residue ellipticities are involved in all three cases, it is clear from these transitions that Gambeta’s unfolding closely parallels that of bB2, rather than that of cB crystallin Although ... 2.00–3.00 A Details of structurally analogous residues are given in column of Table S1, with RMSD values in column We used a combination of visual and software analysis by AreaImol, as implemented ... gene was amplified from this plasmid by PCR using forward primer 5¢-ACTTATACTATCCATATGGGTAAAAT CATCTTCTTTGAACAGG-3¢ and reverse primer 5¢-ACTTATACTATCCTCGAGCCACTGCATATCACGGATAC GACGC-3¢ The forward...

Ngày tải lên: 23/03/2014, 04:21

... and to 3.85 min)1 and KM values of 1250 lm and 850 lm for BApNA and GPpNA, respectively, by means of standard LineweaverBurk analysis of initial rate kinetics Fitting of the experimental data ... Ramachandran Plot for the 20 deposited structures Table S1 Experimental vicinal coupling constants and calculated values for the most representative structure This material is available as part ... structures derived from restrained simulated annealing calculations Ca atoms only are displayed Table Conformational parameters for the 1521 and 2147 regions of LCTI Averaged /,w-values derived from the...

Ngày tải lên: 23/03/2014, 10:21

... Bio-Rad Laboratories Water was obtained using a Milli-Q System (Millipore) All other chemicals were analytical grade For carbohydrate analysis, only freshly prepared reagents thrice-distilled ... analyzed as AMC derivatives (A) Analysis of a blank sample (eluate fraction between peaks in chromatographic profile shown in Fig 3) (B) Analysis of a standard mixture containing Glc, Gal, Man, ... This analysis revealed (for both Ru and UK3 strains) the presence of a galactose residue (the additional 162 Da) in the material of peak (Fig 3A, B) and both galactose and fucose (the additional...

Ngày tải lên: 23/03/2014, 13:20

... of NAACL-03, pages 61–63, NJ, USA Karolina Owczarzak, Josef van Genabith, and Andy Way 2008 Evaluating machine translation with LFG dependencies Machine Translation, 21:95– 119 Karolina Owczarzak ... Riezler 2002 A comparison of evaluation metrics for a broad coverage parser In Proceedings of the LREC Workshop: Beyond PARSEVAL, pages 67–74, Las Palmas, Spain Conclusions Johan Hall and Joakim Nivre ... as well as the strings chosen by the log-linear and language models The standard evaluation procedure relies on both strings being identical to calculate (un-)labelled dependency accuracy, and...

Ngày tải lên: 23/03/2014, 17:20

... complex that was detected in all experiments; and a minor signal of a smaller complex that was detected only in the presence of a certain amount of NaCl (Fig 3D) or in the presence of a smaller amount ... [8–13] and Arabidopsis thaliana [14,15] Yeast, flies, nematodes and mammals encode a single SPO11; however, plants (e.g Arabidopsis and rice Oryza sativa) encode at least three SPO11 paralogues ... was obtained from the Protein Data Bank and was employed as the basal structure A molecular diagram was generated using molfeat, version 2.2.1.8 (FiatLux Co., Tokyo, Japan) The authors would like...

Ngày tải lên: 29/03/2014, 09:20

... separation of the crude venom of Parabuthus transvaalicus Magic bullet C4 column has an equivalent resolving power to an analytical C4 column Fractions P3 and P4 are well resolved using a C4 column, and ... cabbage looper larvae All animal care and experimental protocols conformed to the guidelines of the Animal Use and Care Administrative Advisory Committee of the University of California, Davis Electrophysiological ... to a test potential of )7 mV These voltages were used because the resting potential of these cells is normally around )70 mV, and the voltage that typically activates the maximum, whole-cell Na+...

Ngày tải lên: 31/03/2014, 08:20

... is adaptive with a smallest grid size of nm in critical areas Material properties are obtained from Ref 18 A 30-nm-width slit in a 100-nm-thick aluminum film on a quartz substrate is illuminated ... field of structure in ͑b͒ normalized by a as a function of groove periodicity The slits are illuminated by a 400-nm-wavelength linearly polarized light of the interaction between SPPs and a ... bowtie aperture is excited with a 400-nm-wavelength plane-wave polarized along the y-direction The calculation results indicate a smaller optical spot along the y-direction when the grooves are...

Ngày tải lên: 06/05/2014, 08:53

... Lin H, Bansil A, Grauer D, Hor YS, Cava RJ, Hasan MZ: Observation of a large-gap topological-insulator class with a single Dirac cone on the surface Nat Phys 2009, 5:398 [12] Chen YL, Analytis ... D, Wray L, Xia Y, Hor YS, Cava RJ, Hasan MZ: A topological Dirac insulator in a quantum spin hall phase Nature 2008, 452:970 [10] Hsieh D, Xia Y, Wray L, Qian D, Pal A, Dil JH, Osterwalder J, ... topological insulators have an odd number of massless Dirac cones on the surface, ensured by the Z2 topological invariant of the bulk, while graphene has twofold massless Dirac cones at the K and...

Ngày tải lên: 20/06/2014, 20:20

... Unfortunately, a small value of the step size will make the algorithm converge very slowly, and a large value of the controlling parameter will make the LMS algorithm essentially dominant The rest of ... than one This makes the algorithm go unstable unless either a small value of the step size or a large value of the controlling parameter is chosen such that this unwanted instability is eliminated ... proposed algorithm is detailed The following assumptions which are quite similar to what is usually assumed in literature and which can also be justified in several practical instances are used...

Ngày tải lên: 21/06/2014, 08:20