key regulator of t cell development and differentiation
Báo cáo khoa học: Intermittent hypoxia is a key regulator of cancer cell and endothelial cell interplay in tumours pot
Ngày tải lên :
30/03/2014, 04:20
... endothelial cell radioprotective Fig Schematic representation of the effects of intermittent hypoxia on cancer cells and endothelial cells within a tumour Fig Schematic representation of the ... completely excluded It has to be noted that NF-jB activation by ROS is extremely cell type-dependent Beyond the question of the regulation mechanisms of NF-jB, its activation under intermittent hypoxia ... network is thus critical in the development of a tumour, and therefore the effects of the tumour microenvironment on the cells constituting this network, i.e the endothelial cells, must also be considered...
- 12
- 390
- 0
The role of microRNAs in embryonic stem cell development and differentiation
Ngày tải lên :
12/09/2015, 08:16
... Oct4 not have pluripotent ICM and thus cannot develop past the blastocyst stage (Nichols et al., 1998) This suggests that Oct4 is an essential modulator of pluripotency in vivo, and that it plays ... Furthermore, the network of regulatory interactions that exists in ESCs as suggested by the CHIP data offers the intriguing possibility that these transcription factors may in turn be regulated ... these transcription factors are indicators of ESCs’ pluripotent- or differentiation- status (Loh et al., 2006) Constructs containing either the Oct4 promoter or the Nanog promoter that contain Oct4/Sox2...
- 192
- 377
- 0
Tài liệu Báo cáo khoa học: Identification and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebrafish, Danio rerio docx
Ngày tải lên :
16/02/2014, 09:20
... AGTGAGATGGATACAGGTGCTAAAC TCTGGACCTCAGACATGAACTTACT TGTCAGTCCTCTTTAATGCT AATGGTATCCTGTTTGGCTCAG GGTTGTAATTGTACACGGTAGTC CGGTAGTCAGGAAATCAATGCC CCATGTCTGCAGATGGTCGAGG GGACTGACATTGCTCCAGAGC GCTTCAGTGACTCAGAAATTGG ... TGAGTTACACGTTCAGTCAGCAATATG Real-time TCTTGGTCTTTAGTTCTTATCATCTTGAGC Real-time AAGATTCTCAGCTACATAATGCACACC Real-time ATGCTCATCAGTAGATTCTGCTCAC Real-time ACGCTTCTTCTTTGCGACTG Real-time CACCATATCCCGCTTGAGTT Real-time ... GCTTCAGTGACTCAGAAATTGG GTCCAGAATATTCAGCCTTTCACC CTCCCTCAAACAAACCAGAGTC CACTGGATGAGACAGGAAGTT CTTCTCCAGGACAGTCCAAAGAGTC CTGGATTGAAGCGCCCTCGGTTAATC GCTGCCTTTGTTATTTGTAAGCTTCAG GGAAACTTCCTGTCTCATCCAGTG...
- 20
- 689
- 0
Báo cáo sinh học: "The THO complex as a key mRNP biogenesis factor in development and cell differentiation" potx
Ngày tải lên :
06/08/2014, 19:21
... interesting to know whether the subunits of the THO complex have different roles in the differentiation of distinct cell types And it would certainly be important to understand how the role of the THO ... [1]) This conclusion was strength ned by the observation that sub2 mutants led to e a similar transcription-dependent hyper-recombination phenotype to that of THO-complex mutants and that these ... interacts with ENY2, a protein previously identified as a transcriptional activator that interacts with the SAGA transcription factor, opens up the possibility of a co-transcriptional action of...
- 3
- 247
- 0
Báo cáo y học: " FoxP3 and Bcl-xL cooperatively promote regulatory T cell persistence and prevention of arthritis development" ppt
Ngày tải lên :
12/08/2014, 12:20
... augmenting the differentiation and persistence of Tregs Most significantly, the co-introduction of these molecules into CD4+ T cells resulted in their ability to significantly block the development ... for the treatment of established autoimmune disease Conclusions The results of the present study demonstrate that FoxP3 and Bcl-xL can cooperatively promote the differentiation and persistence of ... long-term survival of Tregs Adoptive cell transfer of FoxP3 plus Bcl-xL-transduced Tregs prevents the development of collagen-induced arthritis To demonstrate that the gene transduction of FoxP3 and...
- 11
- 236
- 0
Development of sphingosine kinase (SPHK) inhibitors and the role of sphingolipids in adult stem cell proliferation and differentiation 2
Ngày tải lên :
11/09/2015, 16:06
... Kim et al., 2008) Thus, we chose to use 25μM to test the potential cytotoxic effects of six compounds generated in this study and compared with the effects of the same amount of and DMS The ratio ... optimized DAG concentration was determined by the lowest amount tested that generated detectable clear signals 43 Chapter2 Development and Evaluation of Human SPHK Inhibitors After the amount of ... possess better capability to penetrate into the cells It can be deduced from Figure 2.6, that CP3 and CP6 possess better penetration capabilities than the other compounds, even though the other compounds...
- 32
- 310
- 0
Development of sphingosine kinase (SPHK) inhibitors and the role of sphingolipids in adult stem cell proliferation and differentiation 3
Ngày tải lên :
11/09/2015, 16:06
... gcacagcaacagtgagcagt FW: gcagagtccagcaaaggt RW: cagccattgatacaggtagc FW: actaccatgagaattgcagtga RW: tcctcagaacttccagaatcag FW: ccacctggactacatcgg RW: tcctcatccctctcatacag FWD: aaccttagatgggggtgtcc RWD: ... adipogenic differentiation In this test, cells were cultured in the differentiation culture conditions with or without different amount of DMS or CP6, and the culture was stopped and analyzed after and ... 3.2.3.1.2 Osteocalcin, Osteopontin, and Osteonectin Expression of DMS/CP6 treated Stem Cells in the Osteogenic Differentiation Besides detecting the degree of the osteogenic differentiation of human...
- 58
- 249
- 0
Development of sphingosine kinase (SPHK) inhibitors and the role of sphingolipids in adult stem cell proliferation and differentiation 4
Ngày tải lên :
11/09/2015, 16:06
... into the cell culture media, part of it will bind with its receptors on the cell surface and trigger downstream signaling pathways; and part of it will penetrate into the cells and directly act ... the stem cells proliferation, what it functioned as: did it function as an extracellular mediator to bind with its receptors and promote cells proliferation? Or it penetrated into the cells and ... osteogenic differentiation potential It should be noted that only osteogenic differentiation potential was selected as a “proof -of- principle” for the MSCs multipotency test 4.2.3.1 Cell Morphologies...
- 31
- 246
- 0
Development of sphingosine kinase (SPHK) inhibitors and the role of sphingolipids in adult stem cell proliferation and differentiation 5
Ngày tải lên :
11/09/2015, 16:06
... is the first report on inhibitors of SPHK mediating human BMand AD- MSCs differentiation into osteogenic and adipogenic paths Thus, the results presented here contribute to the current understanding ... osteogenic differentiation in most of the cases, while at higher amounts (1μM DMS and 5μM CP6) showed to inhibit the osteogenic differentiation in most of the experiments Interestingly, in human BM- and ... reported in the literature The benefit of using this type of MSC is quite obvious, as the cells are extracted from “unwanted” fat Also, the 156 Chapter Conclusion and Future Work procedure of extracting...
- 5
- 268
- 0
Development of sphingosine kinase (SPHK) inhibitors and the role of sphingolipids in adult stem cell proliferation and differentiation 6
Ngày tải lên :
11/09/2015, 16:06
... cells persist, demonstrate site-specific multipotential differentiation, and are present in sites of wound healing and tissue regeneration after transplantation into fetal sheep." Blood Cells Mol ... sphingosine-1-phosphate and platelet-derived growth factor in the maintenance of human embryonic stem cells." Stem Cells 23(10): 1541-8 Peng, H and J Huard (2003) "Stem cells in the treatment of muscle and connective ... "Chondrogenic differentiation of mesenchymal stem cells isolated from patients in late adulthood: the optimal conditions of growth factors." Tissue Eng 12(3): 527-36 Im, Dong-Soon, Christopher E Heise, et...
- 25
- 467
- 0
Development of sphingosine kinase (SPHK) inhibitors and the role of sphingolipids in adult stem cell proliferation and differentiation
Ngày tải lên :
11/09/2015, 16:06
... stem cell differentiation into the subpopulations in a shorter time It will be interesting to know, whether the direct inhibition of SPHK facilitates either embryonic and/ or adult stem cell differentiation ... focused on studying the role of SPHK in adult stem cell differentiation, in an attempt to generate new information in the area of new strategies for stem cell differentiation A number of studies have ... MSCs differentiation; if so, how much they affected the differentiation This study might then provide a new strategy, at a reasonable cost, to promote the stem cells differentiation by shortening...
- 31
- 524
- 0
Tài liệu Báo cáo khoa học: Design, structure and biological activity of b-turn peptides of CD2 protein for inhibition of T-cell adhesion ppt
Ngày tải lên :
19/02/2014, 13:20
... addition to the primary structure of the peptide To confirm our hypothesis that the b-turn structures are important for the inhibitory activities of the peptides, the structures of the cyclic peptides ... patterns, indicative of a stable major conformer at the experimental temperature The structure of peptide cER NMR data of cER indicated the possibility of the b-turn structure in peptide cER The ... inhibitory activity of the cEL peptide and the very low inhibitory activity of the cYT peptide compared to other peptides The flanking residue of the b-turn, i.e Tyr3 of the cVY peptide appears to...
- 14
- 657
- 0
báo cáo hóa học:" Identification of a public CDR3 motif and a biased utilization of T-cell receptor V beta and J beta chains in HLA-A2/Melan-A-specific T-cell clonotypes of melanoma patients" potx
Ngày tải lên :
18/06/2014, 15:20
... clonotypes of melanoma patients Further biases were the frequent association of this public motif with TRBV28 and TRBJ1-5 segments and the lack of rearrangement with members of TRBJ2 cluster The ... ATACCA GGGAC TAGGA 39 GCCTGGAGTGT C C CAGGG CTAGG NA XXXXXXAGT CAT CAGGG ATTGGG 16 GCCAGCA CCCT GACAGGG CTTGGA 6E4 GCCAGCAGTTT TCT 40 GCCAGCAGTTTA B/22 GCCAGCAGT C A .ACAGGG TTTGGG 41 GCCAGCAG ... Frequent contribution of T cell clonotypes with public TCR features to the chronic response against a dominant EBV-derived epitope: application to direct detection of their molecular imprint on the...
- 14
- 532
- 1
Báo cáo hóa học: " Comparison of T-cell receptor repertoire restriction in blood and tumor tissue of colorectal cancer patients" docx
Ngày tải lên :
18/06/2014, 16:20
... study was the application of mathematical markers to describe the global restriction of the αβ TCR repertoire in the different compartments rather than the detection of single expanded T- cell clones ... measurements and analyses NCN collected samples and participated in the conduct of the study ET participated in design and conduct of the study UK participated in design and conduct of the study DN ... calculated the theoretically expected percentage of samples with at least one family elevated more than two SD Statistical methods (n(F) >0) and compared that value with results from all All statistical...
- 9
- 416
- 0
Báo cáo hóa học: " Strategy Escalation: An emerging paradigm for safe clinical development of T cell gene therapies Richard Paul Junghan" pdf
Ngày tải lên :
18/06/2014, 16:20
... (OBD) to establish proofof-concept anti-tumor activity and conditions of safety to normal tissues At this point in time, however, the first studies with 2nd generation designer T cells under Strategy ... reasonable Strategy Escalation increment to a starting test with 109 T cell engrafted is not preceded by a test of 109 T cells infused, but by a test of 1011 T cells infused In the latter case, ... of the potential to shut off growth factor on Tet withdrawal, thereby avoiding need for a prior Strategy trial for patient safety Endnotes This inference of toxicity manageability under Strategy...
- 8
- 474
- 0
Báo cáo hóa học: "Comparison of anti-CD3 and anti-CD28-coated beads with soluble anti-CD3 for expanding human T cells: Differing impact on CD8 T cell phenotype and responsiveness to restimulation" pot
Ngày tải lên :
18/06/2014, 16:20
... (A and B) and CD8 (C and D) T cells To normalize for the impact of persistent growth attributable to primary stimulation, the ratio of growth after restimulation to growth by matched control cells ... could then be quantitated based on the pattern of CFSE fluorescence using Flo-Jo software, and the total number of viable cells per well Bulk stimulation of T cells in vitro To monitor cell phenotype ... restimulation-dependent growth from persistent expansion still attributable to primary stimulation, we calculated the ratio of expansion by stimulated cells/expansion by matched control cells and plotted this...
- 15
- 503
- 0
Báo cáo y học: " Chitosan Interferon-c Nanogene Therapy for Lung Disease: Modulation of T-Cell and Dendritic Cell Immune Responses" pps
Ngày tải lên :
08/08/2014, 21:20
... support the hypothesis that CD8+ T cells are important in allergen-induced lung pathology and that at least a part of the protective effect of CIN treatment can be attributed to a reduction in ... predominant antigen-presenting species in regulating Tcell activation and thus may participate in the protective effect of CIN therapy To determine whether CIN therapy affects the activity of lung ... consistent with the other data in supporting the idea that CIN treatment decreases the inflammatory response to an allergen by inhibiting dendritic cell activation of OVA-specific T cells Alteration of...
- 11
- 486
- 0
Báo cáo y học: "T-cell senescence and contraction of T-cell repertoire diversity – catalysts of autoimmunity and chronic inflammation" pdf
Ngày tải lên :
09/08/2014, 01:23
... T- cell compartment, which is the primary contributor to TCR diversity, was affected in addition to the memory T cells Contraction of diversity in the naive T- cell compartment could not be attributed ... autoimmune manifestations can be prevented by naive T cells that lack any features of regulatory cells but that have the potential of homeostatic expansion Clonal competition is in part antigen ... Irrespective of the primary defect, these data suggest that patients with RA have a history of increased homeostatic proliferation of naive T cells that predated their disease, The immune system...
- 10
- 412
- 0
Báo cáo y học: " Multiple functions for CD28 and cytotoxic T lymphocyte antigen-4 during different phases of T cell responses: implications for arthritis and autoimmune disease" pot
Ngày tải lên :
09/08/2014, 01:23
... differentiate into Th1 and Th2 cells, which secrete distinct sets of cytokines Studies on CTLA-4 expression of differentiated Th1 and Th2 cells have been performed mostly in Th1 and Th2 long-term T cell ... inflammation, the stimulation of antigenexperienced T cells is, at least partly, independent of CD28 signalling, putting CTLA-4/CD80 and CTLA-4/ CD86 into the spotlight of the CTLA-4Ig treatment Furthermore, ... activation of target cells; on the other, blockade of CTLA-4 abrogates the inhibitory function of Treg cells [72] Interestingly, naive T cells, converted to Treg cells by retroviral transduction with the...
- 10
- 393
- 0
Báo cáo y học: "Differential clinical efficacy of anti-CD4 monoclonal antibodies in rat adjuvant arthritis is paralleled by differential influence on κ α NF-κB binding activity and TNF-α secretion of T cell" pot
Ngày tải lên :
09/08/2014, 03:24
... differential contribution of the CD4+ and CD8+ T- cell subpopulation and suggests that interactions between CD4+ and CD8+ T cells [S9] are critical for T- cell activation and the effects of anti-CD4 ... Film Co Ltd) stimulation with ConA were higher than those of PBStreated rats, while T cells of the RIB5/2-treated rats showed proliferation rates similar to those of T cells from PBS-treated animals ... and OX35 (but not the accelerating mAb, RIB5/2) numerically/significantly increased the DTH to the arthritogen M tuberculosis In the total T- cell population, two of the three anti-CD4 mAbs (and...
- 14
- 431
- 0