... gcacagcaacagtgagcagt FW: gcagagtccagcaaaggt RW: cagccattgatacaggtagc FW: actaccatgagaattgcagtga RW: tcctcagaacttccagaatcag FW: ccacctggactacatcgg RW: tcctcatccctctcatacag FWD: aaccttagatgggggtgtcc RWD: ... tightly related to the cells proliferation, was evaluated as a new strategy to promote human MSCs differentiation It is well known that proliferation and differentiation are two of the most fundamental ... these synthetic compounds, CP6 showed to be the best inhibitor candidate, in terms of the ability to penetrate into the cells and inhibit the endogenous SPHK1 and the good yield obtained from the
Ngày tải lên: 11/09/2015, 16:06
... construction of a particular tree is then put back into that tree to test the validity of the classifica- tion obtained from the bootstrap sample. In this way, a test set classification is obtained ... obstacles to addressing these issues. The role of T cells and antigen in the initiation of RA, the mechanisms that drive early fibroblast expansion, and the interplay between T cells and the stromal ... multidimensional scaling to plot the rela- tive similarity between patients in the trees [19]. This allows the magnitude of the difference between groups, and the utility of the data set in distinguishing
Ngày tải lên: 09/08/2014, 06:22
Báo cáo y học: "E3 ubiquitin ligases and their control of T cell autoreactivity" potx
... discuss the mechanisms used by E3 ligases to control the activation of T cells and prevent the development of autoimmunity. Introduction Autoreactive T cells are involved in the development of most ... induction of Th1 differentiation and resultant IFNγ production depends on the activation of STAT4, and this activation event is also antagonized by SOCS3 [24]. Taken together, the results suggest ... activation of Itch itself [68]. Whether the defect in JNK activation that exists in anergic T cells tempers the ability of Itch to ubiquitinate JunB and promote its premature degradation in the
Ngày tải lên: 09/08/2014, 07:20
Báo cáo y học: "Characteristics of T-cell large granular lymphocyte proliferations associated with neutropenia and inflammatory arthropathy" ppt
... genetic evaluation of 21 patients with T- LGL lymphocytosis associated with inflamma- tory arthropathy or with no arthritis symptoms. Our results demonstrate that patients with RA and neutropenia ... Abstract Introduction The purpose of this study was to analyze the data of patients with T- cell large granular lymphocyte (T- LGL) lymphocytosis associated with inflammatory arthropathy or with no ... in these patients, but anemia and recurrent infections as well as RA were con- trolled. In all of the patients, arthritis responded well to the treatment. Two patients with FS and polyclonal T- LGL
Ngày tải lên: 09/08/2014, 10:23
Báo cáo y học: "Small RNA sequencing reveals miR-642a-3p as a novel adipocyte-specific microRNA and miR-30 as a key regulator of human adipogenesis" ppt
... Denmark), at a final concentration of 40 nM for each The sequences of these three DNA/LNA mixmers were 5’-CAGTCGGGGATGTTTAC-3’, 5’-CAGTCGAGGATGTTTAC-3’, and 5’-GAGTGTAGGATGTTTAC-3’ The simultaneous ... established that a pool of multipotent progenitor cells persists in adipose tissue throughout life and is able to differentiate to give rise to adipocytes [1-3] Certain key events controlling the terminal ... achieved with the transfection of a combination of three oligonucleotides that can target and inhibit activity of the whole miR-30 family Over-expression was obtained with transfection of pre-miRNAs
Ngày tải lên: 09/08/2014, 23:20
Báo cáo y học: " Asthma and gender impact accumulation of T cell subtypes" doc
... demonstrate that both type 1 and type 2 T cell subsets increase to a greater extent in asthmatic than control subjects in response to antigen- independent, cytokine-mediated stimulation, with the ... from asthmatic subjects in response to IL-2 suggest the importance of antigen-independent stimulation of T cells in asthma. Cytokine-stimulated (bystander) accumulation of T cells may potentially ... Accumulation of type 1 and type 2 T cell subsets CD3+CD28-mediated stimulation To test whether T cell subsets in freshly isolated PBL differ in their response to a ntigenic stimulation, PBL were stimulated
Ngày tải lên: 12/08/2014, 11:22
Báo cáo y học: "Discrepancy between the in vitro and in vivo effects of murine mesenchymal stem cells on T-cell proliferation and collagen-induced arthritis" doc
... evaluation and to analysis of T- cell proliferation PM contributed to the design of the study and to manuscript preparation All authors contributed to interpretation of the data All authors read and ... reported that intravenous administration of the immortalized MSC cell line C3H1 0T1 /2 to immunized mice had no effect on the development of CIA [26] The treatment protocols and results of these studies ... co-cultures The addition of these inhibitors resulted in the abrogation of the inhibition of Tcell proliferation by wild-type MSCs (Figure 3e) The addition of the IDO inhibitor 1-methyl-DL-tryptophan
Ngày tải lên: 12/08/2014, 11:23
Báo cáo y học: " Mutation of a diacidic motif in SIV-PBj Nef impairs T-cell activation and enteropathic disease" potx
... vitro Taken together, our data reveal that the D-D-X-X-X-E motif is important for both CD3+ T cell activation as well as induction of IL-2 and IL-6 secretion in vivo The activation status of Tcells ... of the Nef202/203GG mutant To analyze the functional activity of the mutated Nef protein, we first determined its ability to suppress NF-AT activation in A3.01 T cells [33,34] We found that both ... Altogether, the data presented here suggest a link between the ability of a lentivirus to induce T- cell activation and cellular proliferation with its ability to cause disease Results Mutant
Ngày tải lên: 13/08/2014, 01:20
Báo cáo y học: " Inhibition of constitutively active Jak-Stat pathway suppresses cell growth of human T-cell leukemia virus type 1-infected T-cell lines and primary adult T-cell leukemia cells" potx
... demonstrated that the activation of Stat3 and Stat5 was mediated by the constitutive phosphorylation of Jak proteins. AG490 inhibited the growth of HTLV-1-infected T- cell lines and primary ATL cells ... Stat3 and Stat5 were not detected in these cells (Figure 2, first and third panels). These results suggest that Tax is not Constitutive activation of Stat3 and Stat5 in HTLV-1-infected T- cell linesFigure ... Stat3 and Stat5 seems to depend on HTLV-1 infection, but not on the expression of HTLV-1 Tax protein. Constitutive activation of Stat3- and Stat5-DNA binding activity in HTLV-1-infected T- cell
Ngày tải lên: 13/08/2014, 09:21
Báo cáo y học: "Association between regulatory T cell activity and sepsis and outcome of severely burned patients: a prospective, observational study" doc
... accumulated the mechanisms underlying its development and how it acts to worsen the morbid state of the critically ill patient are yet to be eluci- dated. In this context, although the majority of ... (85 bp) - TGAACCGGCCTTTCCTGCTTCTCATG (sense), GCG- GAAGTCAATGTACAGCTGCCGC (antisense) [22]; GAPDH (147 bp) -ACTTCAACAGCGACACCCACT (sense), GCCAAATTCGTTGTCATACCAG (antisense) [23]. Statistical analysis ... potentiality to be activated nonspecifically by bacterial products and/ or cytokines, and to regulate through direct cell- cell and/ or soluble mediators. It is our hope that a better understanding
Ngày tải lên: 13/08/2014, 20:21
Báo cáo y học: "he miR-17-5p microRNA is a key regulator of the G1/S phase cell cycle transition" pdf
... negative regulator of cellular proliferation through a protein-protein interaction with its substrate JUN, targeting this transcription factor for protein-degradation Knockout of MAPK9 stabilizes ... phase of HeLa cells This timing allows translational suppression of proteins that affect the activity of proteins that start to accumulate in this phase, and confirms a likely functional action ... target of miR-18a [21]; and PTEN and THBS1 are targets of miR-19a [21,22] Many of these targets are known cell cycle regulators, although none of these interactions are sufficient to explain the
Ngày tải lên: 14/08/2014, 20:22
Study of human nasal epithelial stem or progenitor cell growth and differentiation in an in vitro system
... differentiation may explain the mechanism underlying the histopathological patterns of. .. regulation of Treg and Th cells may contribute to the development of NP As the results of ... validating and comparing hNESPCs morphology and functional activity in the cells from NP and healthy controls, and demonstrated that the intrinsic factors related to cell growth and ... (8):1903-1911. (Impaction factor: 2.27) Yu FG, Li YY, Morshead CM. Induced pluripotent stem cells for the treatment of stroke: the potential and the pitfalls. Current stem cell research & therapy. 2013
Ngày tải lên: 09/09/2015, 11:29
hemotherapy induces intra tumoral expression of chemokines in cutaneous melanoma, favoring t cell infiltration and tumor control
... GGATCTCAAG AAGATCCTTT GATCTTTTCT 1851 ACGGGGTCTG ACGCTCAGTG GAACGAAAAC TCACGTTAAG GGATTTTGGT 1901 CATGAGATTA TCAAAAAGGA TCTTCACCTA GATCCTTTTA AATTAAAAAT 1951 GAAGTTTTAA ATCAATCTAA AGTATATATG AGTAAACTTG ... AGTTCTTTTA ATGATCTAGA 851 ACCGGTCATG GCCGCAATAA AATATCTTTA TTTTCATTAC ATCTGTGTGT 901 TGGTTTTTTG TGTGTTCGAA CTAGATGCTG TCGACCGATG CCCTTGAGAG 951 CCTTCAACCC AGTCAGCTCC TTCCGGTGGG CGCGGGGCAT GACTATCGTC 1001 ... AGTGAGTAGT TTCCGAAGAG TTGTGGCCAT TGCTACTGGC 2351 ATCGTGGTAT CACGCTCGTC GTTCGGTATG GCTTCGTTCA ACTCTGGTTC 2401 CCAGCGGTCA AGCCGGGTCA CATGATCACC CATATTATGA AGAAATGCAG 2451 TCAGCTCCTT AGGGCCTCCG ATCGTTGTCA
Ngày tải lên: 10/09/2015, 15:49
Báo cáo khoa học: Intermittent hypoxia is a key regulator of cancer cell and endothelial cell interplay in tumours pot
... endothelial cell radioprotective Fig Schematic representation of the effects of intermittent hypoxia on cancer cells and endothelial cells within a tumour Fig Schematic representation of the ... completely excluded It has to be noted that NF-jB activation by ROS is extremely cell type-dependent Beyond the question of the regulation mechanisms of NF-jB, its activation under intermittent hypoxia ... network is thus critical in the development of a tumour, and therefore the effects of the tumour microenvironment on the cells constituting this network, i.e the endothelial cells, must also be considered...
Ngày tải lên: 30/03/2014, 04:20
The role of microRNAs in embryonic stem cell development and differentiation
... Oct4 not have pluripotent ICM and thus cannot develop past the blastocyst stage (Nichols et al., 1998) This suggests that Oct4 is an essential modulator of pluripotency in vivo, and that it plays ... Furthermore, the network of regulatory interactions that exists in ESCs as suggested by the CHIP data offers the intriguing possibility that these transcription factors may in turn be regulated ... these transcription factors are indicators of ESCs’ pluripotent- or differentiation- status (Loh et al., 2006) Constructs containing either the Oct4 promoter or the Nanog promoter that contain Oct4/Sox2...
Ngày tải lên: 12/09/2015, 08:16
Tài liệu Báo cáo khoa học: Identification and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebrafish, Danio rerio docx
... AGTGAGATGGATACAGGTGCTAAAC TCTGGACCTCAGACATGAACTTACT TGTCAGTCCTCTTTAATGCT AATGGTATCCTGTTTGGCTCAG GGTTGTAATTGTACACGGTAGTC CGGTAGTCAGGAAATCAATGCC CCATGTCTGCAGATGGTCGAGG GGACTGACATTGCTCCAGAGC GCTTCAGTGACTCAGAAATTGG ... TGAGTTACACGTTCAGTCAGCAATATG Real-time TCTTGGTCTTTAGTTCTTATCATCTTGAGC Real-time AAGATTCTCAGCTACATAATGCACACC Real-time ATGCTCATCAGTAGATTCTGCTCAC Real-time ACGCTTCTTCTTTGCGACTG Real-time CACCATATCCCGCTTGAGTT Real-time ... GCTTCAGTGACTCAGAAATTGG GTCCAGAATATTCAGCCTTTCACC CTCCCTCAAACAAACCAGAGTC CACTGGATGAGACAGGAAGTT CTTCTCCAGGACAGTCCAAAGAGTC CTGGATTGAAGCGCCCTCGGTTAATC GCTGCCTTTGTTATTTGTAAGCTTCAG GGAAACTTCCTGTCTCATCCAGTG...
Ngày tải lên: 16/02/2014, 09:20
Báo cáo y học: " FoxP3 and Bcl-xL cooperatively promote regulatory T cell persistence and prevention of arthritis development" ppt
... augmenting the differentiation and persistence of Tregs Most significantly, the co-introduction of these molecules into CD4+ T cells resulted in their ability to significantly block the development ... for the treatment of established autoimmune disease Conclusions The results of the present study demonstrate that FoxP3 and Bcl-xL can cooperatively promote the differentiation and persistence of ... long-term survival of Tregs Adoptive cell transfer of FoxP3 plus Bcl-xL-transduced Tregs prevents the development of collagen-induced arthritis To demonstrate that the gene transduction of FoxP3 and...
Ngày tải lên: 12/08/2014, 12:20
Development of sphingosine kinase (SPHK) inhibitors and the role of sphingolipids in adult stem cell proliferation and differentiation 2
... Kim et al., 2008) Thus, we chose to use 25μM to test the potential cytotoxic effects of six compounds generated in this study and compared with the effects of the same amount of and DMS The ratio ... optimized DAG concentration was determined by the lowest amount tested that generated detectable clear signals 43 Chapter2 Development and Evaluation of Human SPHK Inhibitors After the amount of ... possess better capability to penetrate into the cells It can be deduced from Figure 2.6, that CP3 and CP6 possess better penetration capabilities than the other compounds, even though the other compounds...
Ngày tải lên: 11/09/2015, 16:06
Development of sphingosine kinase (SPHK) inhibitors and the role of sphingolipids in adult stem cell proliferation and differentiation 4
... into the cell culture media, part of it will bind with its receptors on the cell surface and trigger downstream signaling pathways; and part of it will penetrate into the cells and directly act ... the stem cells proliferation, what it functioned as: did it function as an extracellular mediator to bind with its receptors and promote cells proliferation? Or it penetrated into the cells and ... osteogenic differentiation potential It should be noted that only osteogenic differentiation potential was selected as a “proof -of- principle” for the MSCs multipotency test 4.2.3.1 Cell Morphologies...
Ngày tải lên: 11/09/2015, 16:06
Development of sphingosine kinase (SPHK) inhibitors and the role of sphingolipids in adult stem cell proliferation and differentiation 6
... cells persist, demonstrate site-specific multipotential differentiation, and are present in sites of wound healing and tissue regeneration after transplantation into fetal sheep." Blood Cells Mol ... sphingosine-1-phosphate and platelet-derived growth factor in the maintenance of human embryonic stem cells." Stem Cells 23(10): 1541-8 Peng, H and J Huard (2003) "Stem cells in the treatment of muscle and connective ... "Chondrogenic differentiation of mesenchymal stem cells isolated from patients in late adulthood: the optimal conditions of growth factors." Tissue Eng 12(3): 527-36 Im, Dong-Soon, Christopher E Heise, et...
Ngày tải lên: 11/09/2015, 16:06