key competencies of a sales manager

Family Life, Reproductive Health, and Population Education: Key Elements of a Health-Promoting School docx

Family Life, Reproductive Health, and Population Education: Key Elements of a Health-Promoting School docx

... conducting a situation analysis. It is important to make the analysis manageable and practical so that activities can proceed quickly to the action planning and implementation stage. Too many projects ... 1993). Boys are also at risk of infection and causing unwanted pregnancy. Studies in Africa, Asia, and Latin America showed that 25–27% of young men had multiple partners in the past year, thus ... context of the target audience. The situation analysis may involve gathering qualitative data including anecdotal informa- tion, and quantitative (numeric) data on needs and resources inside and...

Ngày tải lên: 22/03/2014, 12:20

90 469 0
Effective Sales Management Techniques - A Few Important Steps can keep a Sales Manager Focused and His or Her Team Accountable doc

Effective Sales Management Techniques - A Few Important Steps can keep a Sales Manager Focused and His or Her Team Accountable doc

... Each of which has a direct affect on the success of the organization. The sales manager is frequently an active salesperson, as well as an administrator. He or she must make sure quotas are ... times. 1 Effective Sales Management Techniques A Few Important Steps can keep a Sales Manager Focused and His or Her Team Accountable The position of sales manager often comes with multiple ... the state of the market, lack of leads and referrals, inability to get to the decision maker, etc. is usually better at making excuses than making sales. The quandary for the sales manager...

Ngày tải lên: 30/03/2014, 12:21

6 497 1
The closeness of a foreign sales contract in Binh Minh Household Joint Stock Company

The closeness of a foreign sales contract in Binh Minh Household Joint Stock Company

... parties are familiar with available insurance policies, but it is too strict and necessary for an international transaction. Unless parties are assured that the coverage is available in the amount ... contract serves as a guide and a memorial of the agreement that must be followed by both parties. 2.1.2.2. Characteristics of foreign sales contract Basically, a foreign sales contract shares ... in an amicable way. If the parties fail to read an agreement in such way, the dispute shall be brought to the Central of the International Arbitration under Chamber of Commerce and industry of...

Ngày tải lên: 18/04/2013, 08:57

41 617 0
Tài liệu Issues Involved When Updating the Primary Key of a Parent Row pptx

Tài liệu Issues Involved When Updating the Primary Key of a Parent Row pptx

... DataTable. This is the default. None Indicates that no action takes place. SetDefault Indicates that the DataColumn values in the child DataTable are to be set to the value in the DefaultValue ... J6COM. A copy of this row is stored in a DataTable named customersDT. • There is a row in the Orders table that also has a CustomerID of J6COM. A copy of this row is stored in a DataTable named ... change the DataColumn in the parent DataTable on which the ForeignKeyConstraint was created, then the same change is also made in any corresponding DataRow objects in the child DataTable. You should...

Ngày tải lên: 24/12/2013, 01:17

6 429 0
Tài liệu Báo cáo khoa học: Local stability identification and the role of a key aromatic amino acid residue in staphylococcal nuclease refolding pdf

Tài liệu Báo cáo khoa học: Local stability identification and the role of a key aromatic amino acid residue in staphylococcal nuclease refolding pdf

... Institute of Physics, Academia Sinica, Taipei, Taiwan, ROC 3 Department of Biochemistry, University of Minnesota College of Biological Sciences, St Paul, MN, USA Staphylococcal nuclease (SNase) is a ... folding pathway: structure-based analysis of staphylococcal nuclease. Proteins: Structure, Function and Genetics 27, 171–183. 15 Flanagan JM, Kataoka M, Fujisawa T & Engelman DM (1993) Mutations ... Salmon testes DNA and some analytical grade chemicals such as EDTA, Tris ⁄ HCl, CaCl 2 , NaCl and mineral oil were obtained from Sigma (St Louis, MO, USA). Salmon testes DNA for the enzyme activity...

Ngày tải lên: 20/02/2014, 01:20

7 552 0
Báo cáo khoa học: Nup358, a nucleoporin, functions as a key determinant of the nuclear pore complex structure remodeling during skeletal myogenesis docx

Báo cáo khoa học: Nup358, a nucleoporin, functions as a key determinant of the nuclear pore complex structure remodeling during skeletal myogenesis docx

... and 5¢-AUAAGUAAUUUCUACGACG dTdT-3¢; Nup358, 5¢-CCAGUCACUUACAAUUAAAd TdT-3¢ and 5¢-UUUAAUUGUAAGUGACUGGdTdT-3¢ (siNup358-1), 5¢-UGAAGCACAUGCUAUAAAAdTdT-3¢ and 5¢-UUUUAUAGCAUGUGCUUCAdTdT-3¢ (siNup- 358-2)]. ... 5¢-AGCTTATCCTCGTTACAATCAA GAGTAAGTCTCTCAAGCGGTGGTAGCTGAAGAGG A- 3¢) were annealed and inserted into the BglII and HindIII sites of pEGFP-NLS. The oligonucleotide fragment for NES-NLS was flanked ... dystrophy, cardiomyopathy and Dunnigan-type partial lipodystrophy. J Cell Sci 114, 4435–4445. 13 Maeshima K, Yahata K, Sasaki Y, Nakatomi R, Tachibana T, Hashikawa T, Imamoto F & Imamoto N (2006)...

Ngày tải lên: 06/03/2014, 01:20

12 454 0
Components of Software Development Risk: How to Address Them? A Project Manager Survey ppt

Components of Software Development Risk: How to Address Them? A Project Manager Survey ppt

... proponents of software risk management, information about the impact of software risk management has been sparse and anecdotal. There are only a few empirical studies about the commonality and type of software ... identification of risks that are often organizationally sensitive. It demands more courage to air such risks if organizationally accepted risk management procedures are not available. Interestingly, managers ... resource usage and deadline effect. The other items loading to this factor are: evaluation of performance require- ments, managing project complexity, and estimation of hardware and software capabilities....

Ngày tải lên: 07/03/2014, 00:20

15 665 0
Báo cáo khoa học: Studies on structure–function relationships of indolepyruvate decarboxylase from Enterobacter cloacae, a key enzyme of the indole acetic acid pathway ppt

Báo cáo khoa học: Studies on structure–function relationships of indolepyruvate decarboxylase from Enterobacter cloacae, a key enzyme of the indole acetic acid pathway ppt

... of substrate activation of pyruvate decarboxylase: a first approach. Eur. J. Biochem. 92, 175–181. 36. Rivoal, J., Ricard, B. & Pradet, A. (1990) Purification and partial characterization of ... EcIPDC, a discontinuous assay based on HPLC was used [7]. To analyse the kinetic behaviour of the enzyme in more detail, a coupled optical assay was elaborated with alcohol dehydrogenase as auxiliary ... large amounts of indole-3-acetic acid. Indolepyruvate decarboxylase, the key enzyme in the biosynthetic pathway of indole-3-acetic acid, catalyses the formation of indole-3-acetaldehyde and carbon...

Ngày tải lên: 08/03/2014, 02:20

10 430 0
Guidance on the teaching of writing skills INSET opportunities for teachers of a subjects across the curriculum at Key Stages 2 and 3 docx

Guidance on the teaching of writing skills INSET opportunities for teachers of a subjects across the curriculum at Key Stages 2 and 3 docx

... full advantage of this fact. There is a significant body of research evidence to show that learners who speak more than one language have an increased ability to use and learn language in general. ... Welsh language coordinator of a primary or special school and/or the appropriate head(s) of department in a secondary school, a member of the school’s senior management team (SMT) or the LA advisory ... content of the writing of many learners of all abilities is often marred by inaccuracies in spelling, punctuation and grammar. • Less-able learners often make slow progress in their learning because...

Ngày tải lên: 10/03/2014, 05:20

174 616 0
Báo cáo khoa học: Cellulose crystallinity – a key predictor of the enzymatic hydrolysis rate pptx

Báo cáo khoa học: Cellulose crystallinity – a key predictor of the enzymatic hydrolysis rate pptx

... of untreated Avicel. Multivariate statistical analysis of X-ray data The CrI of cellulose samples was also calculated by quanti- fying the contribution of amorphous cellulose (PASC) and Avicel ... shown are the average of quadrupli- cates. Fig. 5. Effect of crystallinity (obtained from X-ray diffraction data and multivariate statistical analysis) on the initial rate in Avicel enzymatic hydrolysis ... carbon signals in NMR analysis could be obtained below a certain degree of crystallinity and within a reasonable acquisi- tion time, so that X-ray diffraction was used as an alternative to map...

Ngày tải lên: 15/03/2014, 10:20

12 554 0
Báo cáo khoa học: Key substrate recognition residues in the active site of a plant cytochrome P450, CYP73A1 ppt

Báo cáo khoa học: Key substrate recognition residues in the active site of a plant cytochrome P450, CYP73A1 ppt

... 5¢-CATTGTTGAAGACATCAATGTTG-3¢ 5¢-CAACATTGATGTCTTCAACAATG-3¢ 43 N302F 5¢-CTTTACATTGTTGAATTCATCAATGTTGCAGC-3¢ 5¢-GCTGCAACATTGATGAATTCAACAATGTAAAG-3¢ 43 I30 3A 5¢-CATTGTTGAAAACGCTAATGTTGCAG-3¢ 5¢-CTGCAACATTAGCGTTTTCAACAATG-3¢ ... 5¢-GAACACAACATTCATTGTTCTCGAAC-3¢ 55 R103E 5¢-GAACACAACATTCTCTGTTCTCGAACC-3¢ 5¢-GGTTCGAGAACAGAGAATGTTGTGTTC-3¢ 55 DKR 5¢-GAAGTTAAAGATACAATGATTCAGCTC 5¢-GAGCTGAATCATTGTAACTTTAACTTC-3¢ 48 N302D 5¢-CATTGTTGAAGACATCAATGTTG-3¢ ... triple mutants. Mutant Sense Primer Antisense Primer T m R101M 5¢-GAGTTTGGTTCGATGACAAGGAATGTTG-3¢ 5¢-CAACATTCCTTGTCATCGAACCAAACTC-3¢ 58 R103M 5¢-GTTCGAGAACAATGAATGTTGTGTTC-3¢ 5¢-GAACACAACATTCATTGTTCTCGAAC-3¢...

Ngày tải lên: 17/03/2014, 10:20

12 380 0
Báo cáo khoa học: The crystal structure of a xyloglucan-specific endo-b-1,4glucanase from Geotrichum sp. M128 xyloglucanase reveals a key amino acid residue for substrate specificity potx

Báo cáo khoa học: The crystal structure of a xyloglucan-specific endo-b-1,4glucanase from Geotrichum sp. M128 xyloglucanase reveals a key amino acid residue for substrate specificity potx

... Biological Resources and Functions, National Institute of Advanced Industrial Science and Technology (AIST), Tsukuba, Ibaraki, Japan 2 Research Institute of Genome-based Biofactory, National Institute ... at both ends. In the case of Xgh7 4A, the active cleft is open. Although a precise anal- ysis of the mode of action of Xgh7 4A has not been performed, Xgh7 4A appears to be an endoglucanase because ... Prism (GraphPad Software, San Diego, CA, USA). One unit was defined as the amount of enzyme that released 1 lmol of glucose equivalent as reducing sug- ars from xyloglucan per minute. Analysis of substrate...

Ngày tải lên: 23/03/2014, 05:22

7 361 0
Báo cáo khoa học: Calpain 3: a key regulator of the sarcomere? pot

Báo cáo khoa học: Calpain 3: a key regulator of the sarcomere? pot

... motifs. Arch Biochem Biophys 342, 99–107. 22 Sorimachi H, Kinbara K, Kimura S, Takahashi M, Ishi- ura S, Sasagawa N, Sorimachi N, Shimada H, Tagawa K, Maruyama K, et al. (1995) Muscle-specific calpain, p94, ... Sorimachi H, Toyama-Sorimachi N, Saido TC, Kawasaki H, Sugita H, Miyasaka M, Arahata K, Ishiura S & Suzuki K (1993) Muscle-specific calpain, p94, is degraded by autolysis immediately after transla- tion, ... Kawamura Y, Kanzawa N, Nakauchi Y, Kimura S, Kawashima S & Maruyama K (1993) A novel domain sequence of connectin localized at the I band of skeletal muscle sarcomeres: homology to neurofilament...

Ngày tải lên: 23/03/2014, 10:21

10 350 0
Báo cáo Y học: Heterologous expression of a Rauvolfia cDNA encoding strictosidine glucosidase, a biosynthetic key to over 2000 monoterpenoid indole alkaloids pot

Báo cáo Y học: Heterologous expression of a Rauvolfia cDNA encoding strictosidine glucosidase, a biosynthetic key to over 2000 monoterpenoid indole alkaloids pot

... (5¢-GGAGGGTGGCAGCATGTCGTTCCTTGG GG-3¢,forward),GSP 5a( 5¢-GTGGCTTCTTGAGTCAT AGAATCGTGGATGAC-3¢, reverse) and GSP5b (5¢-GT GCATACAACGAAGGCAATCGAGGTCC-3¢, reverse) using Marathon TM cDNA Amplification ... & Hughes, M .A. (1994) Investigation of theactivesiteofthecyanogenicb- D -glucosidase (linamarase) from Manihot esculenta Crantz (cassava). II. Identification of Glu-198 as an active site carboxylate ... was extracted with an equal volume of EtOAc, pH of the water phase adjusted to 8.0 with 25% ammonia and extraction with equal volume of EtOAc repeated. The organic phases were evaporated and chromatographed...

Ngày tải lên: 24/03/2014, 03:21

10 650 0
Báo cáo khoa học: Intermittent hypoxia is a key regulator of cancer cell and endothelial cell interplay in tumours pot

Báo cáo khoa học: Intermittent hypoxia is a key regulator of cancer cell and endothelial cell interplay in tumours pot

... 728–733. 72 Hayakawa M, Miyashita H, Sakamoto I, Kitagawa M, Tanaka H, Yasuda H, Karin M & Kikugawa K (2003) Evidence that reactive oxygen species do not mediate NF-kappaB activation. EMBO ... vas- cular endothelial growth factor stress response increases the antitumor effects of ionizing radiation. Cancer Res 59, 3374–3378. 101 Kanaan A, Farahani R, Douglas RM, Lamanna JC & Haddad ... enzymes that lead to extracellular matrix degra- dation (matrix metalloproteases) [75–78]. In addition, NF-jB activation was reported as an early event in malignant transformation in vitro [79], and...

Ngày tải lên: 30/03/2014, 04:20

12 390 0
w