... osmolytes in plants subject to salt stress are GB, b-alaninebetaine, prolinebetaine, choline-O-sulphate, hydroxyprolinebetaine, and pipecolatebetaine (Ashraf and Abiotic Stress Responses in Plants: ... Acids, Proline, and Amides It has been reported that amino acids (such as alanine, arginine, glycine, serine, leucine, and valine, the nonprotein amino acids citrulline and ornithine (Orn)), ... 2006; Khan et al 2007; Mobin and Khan 2007; Hsu and Kao 2007) Increased activities of GR during drought stress were observed in different plants, e.g in wheat (Selote and KhannaChopra 2006) and in...
Ngày tải lên: 14/03/2014, 10:20
... phosphoinositidedependent kinase-1 (PDK-1), novel protein kinase (PKN), p42 ⁄ 44 MAPK and MEK were analyzed as the signaling molecules involved in InR signaling [19,23] Expression of b catenin and its downstream ... (2003) GSK-3: tricks of the trade for a multi-tasking kinase J Cell Sci 116, 1175– 1186 32 Shoukat D, Benjamin W & Gregory H (1999) Integrinlinked kinase (ILK): a regulator of integrin and growth ... FucTVII-H PKB-T308 PKB-S473 PKB β-actin D 400 350 300 Relative PKB kinase activity Mock β-actin 200 150 100 50 E PKB-T308p Mock PKB-S473p FucTVII-M PDK-1 200 PKN 100 p-PKN β-actin Mock FucTVII-M...
Ngày tải lên: 16/03/2014, 12:20
Báo cáo hóa học: " Respiratory syncytial virus (RSV) attachment and nonstructural proteins modify the type I interferon response associated with suppressor of cytokine signaling (SOCS) proteins and IFN-stimulated gene-15 (ISG15)" potx
... ability of RSV to induce expression and catalytic activity IKKε which blocks RSV-induced IRF3 phosphorylation, nuclear translocation and DNA-binding, and leading to inhibition of cytokine gene transcription, ... and protein was similar between ΔNS1/2 and WT virus infection of MLE-15 cells, it is unlikely NS1/ NS2 has a role in modifying ISG15 The finding in this study that G protein expression inhibits ... Methods Viruses and cells Type I IFN-free virus stocks of recombinant RSV strain A2 (6340WT), 6340WT lacking the G protein gene (6340 G), and 6340WT lacking NS1 and NS2 genes (ΔNS1/2) (kind gift of...
Ngày tải lên: 20/06/2014, 01:20
Báo cáo sinh học: "Imp-L2, a putative homolog of vertebrate IGF-binding protein 7, counteracts insulin signaling in Drosophila and is essential for starvation resistance" ppt
... the reported binding of IGFBP-7 to insulin awaits confirmation [7,8], it can compete with insulin for binding to the insulin receptor (InR) and inhibit the autophosphorylation of InR [6] Furthermore, ... affinity of IGFBP-7 for insulin [6] Interestingly, Imp-L2 has been shown to bind human insulin, IGF-I, IGF-II and proinsulin, and its homolog in the moth Spodoptera frugiperda, Sf-IBP, can inhibit ... version lacking the second Ig C2-like domain - binds Dilp2, consistent with previous findings that Imp-L2 binds human insulin, IGF-I, IGF-II and proinsulin [22] Thus, despite lacking any clear...
Ngày tải lên: 06/08/2014, 18:21
Báo cáo khoa học: "The relationship among acute-phase response proteins, cytokines and hormones in cachectic patients with colon cancer" doc
... S, Sekeroglu MR, Erkog R, Ozbek H, Noyan T, Yavuz M: Serum levels of leptin and proinflammatory cytokines in patients with gastrointestinalcancer Int J Clin Pract 2004, 58:545-549 Kemik et al ... of circulating IL-6 and midkine, independently of the patients weight status, and with Il-1, Il-8 and VEGF in cachectic cancer patients TNF-a, IL-1 and IL-6 are key cytokines involved in cancer-related ... loss and levels of pro-inflammatory cytokines, cytokins, APRP, adiponectin, ghrelin and leptin leves have not been explained yet We suggested that adiponectin, ghrelin and leptin are tightly regulated...
Ngày tải lên: 09/08/2014, 03:22
báo cáo khoa học: " Cellular localization of ROS and NO in olive reproductive tissues during flower development" doc
... Vandelle E, Poinssot B, Wendehenne D, Bentéjac M, Pugin A: Integrated Signaling Network Involving Calcium, Nitric Oxide, and Active Oxygen Species but Not Mitogen-Activated Protein Kinases in ... Paulownia tomentosa in vitro Physiol Plant 2007, 131:273-282 12 McInnis S, Emery DC, Porter R, Desikan R, Hancock JT, Hiscock S: The role of stigma peroxidases in flowering plants: insights from further ... signalling ) and reveal the complex interrelationships taking place between the plethora of enzymatic activities involved in their production, the high number of potential substrates and products involved...
Ngày tải lên: 12/08/2014, 03:21
Protein turnover in tissues effects of food and hormones
... ảnh Randomization Trong bước liệu vector lấy từ bước Freature Extraction tạo băm việc sử dụng khóa K Nêu khóa K không tính giá trị băm ảnh 11 Các bước băm ảnh số Quantization K t bước ... Hàm băm thuật toán không dùng khóa để mã hóa, có nhiệm vụ “lọc” (băm) tài liệu (bản tin) cho k t giá trị băm có k ch thước cố định, gọi “đại diện tài liệu” hay “đại diện tin”, “đại diện thông ... k ch thước liệu băm Encoding Chuyển k t bước Quantization chuyển thành bit 12 Ứng dụng băm ảnh số Tạo mục hỗ trợ tìm kiếm liệu ảnh hệ quản trị sở liệu đa phương tiện, công cụ tìm kiếm internet...
Ngày tải lên: 19/10/2014, 20:02
Contributions of Various Noncovalent Bonds to the Interaction between an Amide and S-Containing Molecules
... Amide and S-Containing Molecules b and c indicates that the benefit of forming CHãããS and SHãããp H-bonds, even weak ones, is worth the stretching and bending of the SHãããO in b The next minimum ... 4.90 kcal mol1 to this struc- CH3SSCH3/NMA heterodimer Large blue numbers represent binding energies, in kcal mol1 ture Indeed, CHãããO and CHãããS H-bonds occur in Distances in and angles in degrees ... the binding of 4.40 kcal mol1 of the next minimum i The next minimum j repeats some of the prior interactions, including the donation from both the CO p and p* orbitals into s*(SS) A new interaction...
Ngày tải lên: 16/12/2012, 15:21
WCDMA UTRAN Interface and Signaling Procedure ISSUE 1.1
... Page36 CN Introduction of System Information MIB : Contains PLMN tag and SB (scheduling information block) or the scheduling information for SIB (system info block) SB1 : Contains scheduling information ... Cell-FACH In active state Few data to be transmitted both in uplink and in downlink There is no need to allocate dedicated channel for this UE Downlink uses FACH and uplink uses RACH ... often, its decoding is controlled by a timer SIB11 : Contains measurement controlling information SIB12 : Contains measurement controlling information in connecting mode SIB13 : Contains ANSI-41...
Ngày tải lên: 23/10/2013, 03:11
Tài liệu Báo cáo khoa học: miRNAs and regulation of cell signaling pptx
... Terasawa K, Shimizu K & Tsujimoto G (2010) MicroRNA-34a inhibits cell proliferation by repressing mitogen-activated protein kinase kinase during megakaryocytic differentiation of K5 62 cells Mol Pharmacol ... miRNAs and cell signaling A Ichimura et al A Signal MAPKKK 5´ CUAGCCAGAGCCCUUCACUGCCA |||| ||||||| 3´ UUGUUGGUCGAUUCU-GUGACGGU MAP 2K1 3´ UTR hsa-miR-34a ERK-MAPK signaling MEK miR-34a p53 Signaling ... repressing the indicated targets and presumably hundreds of other as yet unidentified targets (B) miR-34a and the miR-34a-binding site in the 3¢ UTR of genes shown in (A) involved in the feedback control...
Ngày tải lên: 14/02/2014, 19:20
Tài liệu Báo cáo khoa học: Mixed lineage leukemia: roles in gene expression, hormone signaling and mRNA processing docx
... that includes a DNA-binding domain, a ligand-binding domain and a transactivation domain The DNA-binding domain is responsible for DNA binding specificity and dimerization, and the ligand-binding ... K I Ansari and S S Mandal Biochemical functions of MLL MLL Me Me Me H3 K7 9 K7 9 K3 6 K3 6 K2 0 H2A H2A Me Me K4 K4 K9 H3 Activation H2B H2B K2 7 K2 7 Me H4 Silencing Me K1 20 K1 20 H4 Silencing Activation ... selective and independent roles within the hematopoietic system, maintaining quiescence in HSCs and promoting proliferation in progenitors [23] Similarly, in an independent study using a conditional knockout...
Ngày tải lên: 16/02/2014, 14:20
Tài liệu Báo cáo khoa học: Myristoylation of the dual-specificity phosphatase c-JUN N-terminal kinase (JNK) stimulatory phosphatase 1 is necessary for its activation of JNK signaling and apoptosis pdf
... MKK4 and MKK7 [6,7], with MKK7 primarily responding to cytokines, whereas MKK4 is preferentially activated by environmental stress [5,8] Depending on the stimulus and cellular context, the JNK ... blocked in 5% nonfat dried milk in Tris-buffered saline containing 0.05% Tween 20 and incubated with primary antibody [phospho-SAPK ⁄ JNK (Cell Signaling Technology, Danvers, MA, USA), JNK1 ⁄ JNK2 ... splicing The Jnk1 and Jnk2 genes are expressed ubiquitously, whereas expression of Jnk3 is largely restricted to brain, heart and testis [4,5] JNK is phosphorylated and activated by the MAPK kinases...
Ngày tải lên: 16/02/2014, 14:20
Tài liệu Báo cáo khoa học: a-Defensins increase lung fibroblast proliferation and collagen synthesis via the b-catenin signaling pathway doc
... obtained data indicating that a-defensin-1 and a-defensins-2 induce an increase in the protein content of cyclin D and that quercetin inhibits the a-defensininduced increase in cyclin D protein ... GSK3b without an alteration in the protein contents of total p38 MAP kinase, total Akt, and total GSK3b, suggesting that a-defensin-1 and a-defensin-2 cause the activation of p38 MAP kinase and ... defensin-induced increases in lung fibroblast proliferation and in collagen synthesis, the protein expression of b-catenin in lung fibroblasts (HFL-1) was knocked down by using its small interfering...
Ngày tải lên: 18/02/2014, 06:20
Tài liệu Báo cáo khoa học: DNA methylation-mediated nucleosome dynamics and oncogenic Ras signaling pptx
... a 21-kDa guanine nucleotide-binding protein, which plays a role in the regulation of growth and differentiation in eukaryotic cells [1,82] Despite profound improvements in our understanding of ... oncogenic K- Ras and are involved in the recruitment of DNMT1 and other chromatin modifiers to the promoter, resulting in DNA methylation and epigenetic silencing In support of this hypothesis, knockdown ... the phosphatidylinositol 3-kinase pathway was involved in mediating this effect of RAS The involvement of phosphatidylinositol 3-kinase points to the possibility that some of the known anti-apoptotic...
Ngày tải lên: 18/02/2014, 14:20
Tài liệu Báo cáo khoa học: Osmotic stress sensing and signaling in fishes doc
... upstream regulator of MAPK cascades, mitogen-activated protein kinase kinase kinase interacting protein (TAK binding protein ¼ TAB 2), as an IEG during hyperosmotic stress in tilapia gill epithelium ... transiently and very rapidly (within h) induced by hyperosmotic stress, indicating a role of this mitogenactivated protein kinase kinase kinase interacting protein for osmosensory signal transduction in ... takes place in the order of minutes to hours and involves many hormones, including arginine vasopressin, angiotensin II, natriuretic peptides, vasoactive intestinal peptide, urotensin II, insulin...
Ngày tải lên: 18/02/2014, 16:20
Tài liệu Báo cáo khoa học: Osmosensing and signaling in the regulation of mammalian cell function docx
... Thus, integrin-dependent cell volume sensing and signaling integrates into the overall context of insulin signaling Similarly, sensing of glutamine-induced hepatocyte swelling by integrins feeds into ... [12–14] Integrin-inhibitory peptides exhibiting an arginine-glycine-aspartic acid (RGD) motif abolish hypoosmotic osmosignaling towards Src-type kinases, mitogen-activated protein kinases (MAPKs) and ... Osmosensing and signaling in mammalian cell function F Schliess et al [7] On the other hand, hyperosmotic shrinkage prevents insulin-induced hepatocyte swelling and proteolysis inhibition, indicating...
Ngày tải lên: 18/02/2014, 16:20
Tài liệu Báo cáo khoa học: Dual P2Y12 receptor signaling in thrombin-stimulated platelets – involvement of phosphoinositide 3-kinase b but not c isoform in Ca2+ mobilization and procoagulant activity pdf
... SO (1993) ADP- and thapsigargin-evoked Ca2+ entry and protein-tyrosine phosphorylation are inhibited by the tyrosine kinase inhibitors genistein and methyl-2,5-dihydroxycinnamate in fura-2-loaded ... with the PKA inhibitors, KT5720 and H89 [28] Following saponin permeabilization, this resulted in increased InsP3-induced Ca2+ release with either inhibitor, with an EC50 of lm KT5720 and lm H89 ... earlier work investigating the interaction of P2Y12 with P2Y1 signaling [25,40] We find that P2Y12 enhances the thrombin-induced Ca2+ response in a way not only involving adenylyl cyclase ⁄ PKA inhibition,...
Ngày tải lên: 18/02/2014, 16:20
Tài liệu Báo cáo khoa học: The effect of small molecules in modulating the chaperone activity of aB-crystallin against ordered and disordered protein aggregation pdf
... Alpha-crystallin: its involvement in suppression of protein aggregation and protein folding In Protein Folding Handbook: Part II (Buchner J & Kiefhaber T, eds), pp 858–875 Wiley-VCH, Weinheim, Germany ... Planar stacking interactions of arginine and aromatic side-chains in proteins J Mol Biol 235, 709–717 43 Lindner RA, Treweek TM & Carver JA (2001) The molecular chaperone a-crystallin is in kinetic ... monitored in real time by incubation at 37 °C in 50 mm phosphate buffer, pH 7.2, without shaking for 15 h Single-point ThT readings were taken for a-synucleinA53T during incubation at 37 °C in 50...
Ngày tải lên: 18/02/2014, 16:20
Tài liệu Báo cáo khoa học: Compartmentalization and in vivo insulin-induced translocation of the insulin-signaling inhibitor Grb14 in rat liver pptx
... phosphorylation in both activation and inhibition of the insulin receptor tyrosine kinase in vivo Endocrinology 137, 4960– 4968 24 Kelly KL & Ruderman NB (1993) Insulin-stimulated phosphatidylinositol 3-kinase ... PDK-1 [14], IRS-1 [13], and tankyrase [15] The binding of ZIP to Grb14, by recruiting protein kinase Cf, enhances the serine phosphorylation of Grb14 and its inhibitory effect on IR kinase and ... Desbuquois et al Insulin-induced translocation of Grb14 in rat liver A H N B M LP S PM GE –ins Grb14 – ins Grb14 + ins –ins + ins + ins – ins EEA1 + ins Na +K+ ATPase Calnexin + ins number: 10 11...
Ngày tải lên: 18/02/2014, 18:20
Tài liệu Báo cáo khoa học: What MAN1 does to the Smads TGFb/BMP signaling and the nuclear envelope Luiza Bengtsson pdf
... Exhibits a DNA Binding Winged Helix Domain J Biol Chem 281, 18208– 18215 Gajiwala KS & Burley SK (2000) Winged helix proteins Curr Opin Struct Biol 10, 110–116 Gareiss M, Eberhardt K, Kruger E, Kandert ... R-Smads and 3), the coSmad Smad4 and the inhibitory Smads and All R-Smads and the co-Smad consist of three domains: the N-terminal MH1 domain, the variable proline-rich linker, and the C-terminal ... LEM domain alone is sufficient to bind BAF (Fig 1; [8]) Prelamin A and BAF are also binding partners of emerin [39] Interestingly, the N-terminus of human MAN1 binds the human emerin itself (Fig...
Ngày tải lên: 19/02/2014, 02:20