j c huang university of houston

... Dysmicoccus brevipes—pineapple mealybug Planococcus citri Pseudococcus adonidum P comstocki P longispinus—longtailed mealybug* Eriococcidae—mealy scales Dactylopidae—cochineal scales Dactylopius coccus* ... Galerucinae Diabrotica undecernpunctata— s p o t t e d c u c u m b e r beetle* B r u c h i d a e — s e e d beetles Acanthoscelides* Callosobruchus Pachymerius nucleorum—bicho de coco Curculionidae—weevils ... , 435 Cocconotus, 154, 155 C o c h i n e a l b u g , 4, 5, , Cochhomyia: hominovorax, , 364, - 0 ; macellana, 399 Cochlospermaceae, 299 Cochlosperrnum, 299 C o c k r o a c h : A m e r i c a n

Ngày tải lên: 14/05/2019, 13:40

... performance hit of using a method to access the data Property A property is an item of data which is held in an object An example of a property of a BankAccount class would be the balance of the account ... to an item in the processor Each particular range of computer processors has its own specific machine code, which means that machine code written for one kind of machine cannot be easily used ... BankAccount) and the classes at the lower levels will be more specific (for example ChildBankAccount) Immutable An immutable object cannot be changed If an attempt is made to change the content of

Ngày tải lên: 08/03/2014, 11:20

... of purchase A complete model of response to pricing should capture these effects of reference price Any of the models discussed above can account for reference price effects by including ... vectors of coefficients to be estimated, and εt = a vector of error terms initially assumed... logit model of brand choice calibrated on scanner data Marketing Science, 2, 203–238 McCarthy, ... example, βA captures the main effect of advertising by hour of the day A combination of λ and βA captures the carryover effect of advertising ? ?c captures the effects of various creatives

Ngày tải lên: 15/03/2014, 22:20

... draw on the evidence collected in the Forecasting Principles Project, which is described on the website forecastingprinciples.com. The evidence is provided in Principles of Forecasting: A Handbook ... (1975), 93 percent of the companies sampled indicated that sales forecasting was one of the most critical' aspects, or a ‘very important’ aspect of their company's success. Jobber, Hooley ... variables can be accurately forecast or controlled, especially with respect to their direction. If any of these conditions does not hold (which is typical for short-range forecasts), econometric

Ngày tải lên: 23/03/2014, 03:20

... ttaggtagttttttaacgcacttacttct 5- gccgtcggaaccgtcccgacttcctaaca 6- ttttgagacatggtcgtttcgttttgaat 7- ctaatgagcattcattacatatgtagaac 8- ttatcgtagtgccatctaacaaatgctag 9- ttcctctggtaaattcttaatgtctgcat 10-ccgtaagttattagaaaaatatccaacca ... CRISPR1 Consensus for the repeat: g ttttagagtcatgttgtttagaatggtaccaaaact Unique sequences 1- ttgccacttgcgagcttcaccagagctat 2- aggtttcaagtgtgaataggtacggtctt 3- ataaattctacccccatgttataaaacgg 4- ... 10-ccgtaagttattagaaaaatatccaacca 11-ctaatttaaaggcaaaggcaagaatagaa 12-taatgtcaaaacagcagctacatttctcc 13-gggttgactaaagagccgtcaaaagtttt 14-caagaaattgcattaagttcaaaaaattt (a) (b) (c) E F0 6 7 2 O G 1 _

Ngày tải lên: 14/08/2014, 20:22

... work was to make collections of specimens, and to have the microscopic examinations, chemical analyses and physical tests made of them, which would show their composition, structure, hardness, ... in Scarsdale, quarry at • "Sche ne ctady blue-stone" Schenectady county quarries Sch oha rie county, quarries in Schuyler county quarries • •• Seneca Falls qual 'J' ies Seneca county, ... them to be incorporated with the discussion of the occurrence, prop­ erties and general, economic relations of the building stone, which is used in our State In conclusion, I must acknowledge my

Ngày tải lên: 23/11/2018, 23:27

... (2103) Cultivating social competence in young children: Teachers’ beliefs about and practices involving the development of children’s social competence Unpublished doctoral dissertation, University ... 1996) A useful distinction can be made between large, upper-case, Big -C CULTUREs— Japanese culture, Maori culture, American culture—and small, local, lower-case, little -c cultures—the many groups ... revisited: China, Japan, and the United States Chicago, IL: University of Chicago Walsh, D J (2002) The development of self in Japanese preschools: Negotiating space In L Bresler & A Ardichvili (Eds.),

Ngày tải lên: 19/10/2022, 11:57

... evaluated and compared with that of the original frames in a companion paper References: American Institute of Steel Construction, Inc., Manual of Steel Construction, Chicago, IL, 1989 American Institute ... The Automatic Design of Structural Frames, Quarterly Journal of Mechanics and Applied Mathematics, Vol 9, 1956 Maxwell, C. , Scientific Paper II, Cambridge University Press, 1890 Mercado, L., and ... are functions of the cross sections of the members, which is the case for most structural optimization problems, they are often chosen from a limited set of available sections For instance, steel

Ngày tải lên: 25/10/2022, 08:08

... GCCAGCAGCCCAACGAATATCGCGTATTCCTATGAGCAGTAT GCCAGCAGCCAGGGACCCAATACAGATCCCCTTTAC GCCAGCAGCCCAACTCCGACCTATGATGAGCGGCAC GCCAGCAGCGGGAGCAATAACCCTCTGTAT GCCAGCAGCCAGTGGAGCAACCAGGCACAGCAC GCCAGCAGCCAGTCACGCAGGGATAGCAACCAGGCACAGCAC GCCAGCAGCCTATCGACTGTCGATAGCCAAAGCACTCAGTAC ... GCCAGCAGCTCAGTcagcgACGGGGAGCTGCAC GCCAGCAGCCCCGCGGTAgggaGTGATAACCCTCTGTAT GCCAGCAGCCCTCAgacagcggggGAAGATCCCCTTTAC GCCAGCAGCAAGGGCAggacagcggggcCTAGCAATAACCCTCTGTA GCCAGCAGCTggacaCTGAACGCCGCGCAGCTGTAC ... GCCAGCAGCCAAggacagGATCGGATTAACCCTCTGTAT GCCAGCAGCCCAGATCCggacagcggcgCCGCGCAGCTGTAC GCCAGCAGCCAAGACATCTCGcagcgggcCACAGATCCCCTTTAC GCCAGCAGCCAGAAGAggacagcgggTGAGCGGCAC GCCAGCAGCCTgggacagcggggAGGGTATGAGCAGTAT GCCAGCAGCTCAGTcagcgACGGGGAGCTGCAC

Ngày tải lên: 02/11/2022, 10:40

... voc n ăn z thạ Luận vălunậ caáo n lhọ n uậ ccao c s luận văn khvoa ă n c xãhhộĩ v i luận văn vnu n 1họ 23 ăn v ? ?c nhân văn nu cz 1 1 Lu Lu ận vă Luận vănđồ12ậ3d n voc n ăn z thạ Luận vălunậ caáo ... ccao c s luận văn khvoa ă n c xãhhộĩ v i luận văn vnu n 1họ 23 ăn v ? ?c nhân văn nu cz THƢ VIỆN TRƢỜNG ĐẠI H? ?C DƢ? ?C HÀ NỘI Chuyên ngành: Khoa h? ?c Thông tin - Thƣ viện Mã số 60320203 LUẬN VĂN TH? ?C ... H? ?C QU? ?C GIA HÀ NỘI TRƢỜNG ĐẠI H? ?C KHOA H? ?C XÃ HỘI VÀ NHÂN VĂN PHẠM THỊ TUYẾT PHÁT TRIỂN NGUỒN L? ?C THÔNG TIN SỐ TẠI Lu Lu ận vă Luận vănđồ12ậ3d n voc n ăn z thạ Luận vălunậ caáo n lhọ n uậ ccao

Ngày tải lên: 20/07/2023, 15:26

... taught in conjunction with communicative practices for the learner to be able to communicate effectively with native speakers 1.3 Approaches to teaching pronunciation According to Celce-Murcia’s ... describes as one of ‘speech coach or pronunciation coach’ Rather than just correcting the learner’s mistakes, the ‘speech coach’ ‘supplies information, gives models from time to time, offers cues, ... specific linguistic competencies to broader communicative competencies as goals for teachers and students Morley states the need for the integration of pronunciation with oral communication, a change

Ngày tải lên: 07/09/2013, 13:45

... important for teachers to apply good methods in ESP classes because good methodology decides most of the success of the classroom. Generally speaking, because of the characteristics of ESP, when ... linguistics competencies but also academic and job-related skills. Strevens (1988:1), by contrast, stated that “ESP is a particular case of the general category of special – purpose language teaching”. ... types of reading. 6 I.2. Classification of reading. I.2.1. Classification of reading according to manner. According to manner, reading aloud and silent reading are two types of reading in which

Ngày tải lên: 07/09/2013, 13:45

... technology is crucial to CUNY’ success s City University of New York Providing a high-quality, Providing Access to Academic Excellence As a public institution of higher learning, the City University ... performance is determined by the interaction between transceivers (active components such as hubs, switches and NICs) and the cabling system (passive components such as cable, patch cords and connectors) ... world-renowned scholars teaching THE CITY UNIVERSITY OF NEW YORK NOW BOASTS 10 SENIOR COLLEGES, SIX COMMUNITY COLLEGES, A DOCTORAL-GRANTING GRADUATE SCHOOL, A LAW SCHOOL, AN ACCELERATED MEDICAL PROGRAM

Ngày tải lên: 20/12/2013, 22:15

... very necessary and useful B not necessary and useful C no idea Please rate the importance of the following objectives needed to be achieved at the end of ESP speaking course for the second year ... Please rate the importance of the tasks using English in your job by putting a tick in the appropriate box Tasks Very Necessary necessary Not No Necessary Respond Contacting with clients Using the ... information Your choice Complaining on the 19 Giving directions telephone Telephoning to make an 20 Choosing a hotel order Participating in discussions 21 Giving regulations & advice 22 Focusing competitors

Ngày tải lên: 25/12/2013, 20:21

... components necessary to carry out an upcoming task. Selective attention Deciding in advance to attend to specific aspects of input, often by scanning for key words, concepts and/or linguistic markers. ... that contribute indirectly to learning, includes creating practice opportunities and using production tricks such as communication strategies. An alternative classification scheme proposed by Naiman ... learning, includes clarification/verification, monitoring, memorization, guessing/inductive reasoning, deductive reasoning and practice. The second category, consisting of strategies that contribute

Ngày tải lên: 29/01/2014, 10:33

... makes effective use of didactic resources (blackboard, cassette, video, IT, ect.) +  30. T assesses student work on the spot, checks the answers with the whole class, corrects typical errors ... enough support and offers such variation as does justice to the proficient differences between students + 26 T stimulates students to reach... of subject at school, such 2 as the English, ... Discussion 16 Individual writing + 17 Collaborative writing 18 Interviewing 0 0 19 Communicative Games C - Didactical evidences 20 T shows enthusiasm for the subject s/he teaches 21 T connects

Ngày tải lên: 29/01/2014, 10:58

... expected source of enjoyment 106 Discussion 109 Limitations of study and research implications 112 Clinical implications 114 Reflexivity 115 Children, young people and Coeliac Disease Conclusions ... Disease? Why focus on children and adolescents? Method Search strategy Inclusion and exclusion criteria Data extraction 10 Description of studies 10 Participants 29 Country of origin 29 Recruitment ... Children, young people and Coeliac Disease Volume II Volume II comprises five Clinical Practice Reports: Clinical Practice Report describes the “challenging behaviour” of a 42 year old man with learning

Ngày tải lên: 12/02/2014, 12:20

... particularly on the statistical analysis of accident data (predictive accident modelling, safety scheme evaluation and accident migration). Current research is concerned with the impact of speed ... research into new practices. These techniques have applications in the conservation of our oldest and most famous structures. It is of commercial, cultural and scientific importance, especially ... ết c ấu đ ư c s ử d ụng trong x ây d ựng c ông tr ình cho ph ép x c đ ịnh ch ính x c b ản ch ất v à đi ều ki ện l àm vi c c ủa c c k ết c ấu. Khoa c ó r ất nhi ều king nghi ệm v à th ực...

Ngày tải lên: 07/09/2012, 09:51

... with a specialist of the subject area, sharing experience with students, etc the ESP teacher can “pick up” a lot of knowledge of the subject matter. Sharing the same point of view with Hutchinson ... linguistics competencies but also academic and job-related skills. Strevens (1988:1), by contrast, stated that “ESP is a particular case of the general category of special – purpose language teaching”. ... treatment. Each unit has four sections. Section 1 introduces new language related to the unit theme. Section 2 provides further practice and introduces a variety of medical documents. Section 3 focuses...

Ngày tải lên: 07/11/2012, 14:50

... of exercise types and activities with a communicative approach is unlimited, provided that such exercises and activities enable learners to attain the communicative objectives of the curriculum, ... of learners through an analysis of genuine, realistic situations 6 3.1. Research context The study was conducted at Vietnam University of Commerce. The Faculty of English at University of Commerce ... the characteristics of CLT, if precisely understood, may help teachers translate the theory of CLT into classroom reality and make their classroom “communicative”. Li (1998:679) reviews CLT characteristics...

Ngày tải lên: 07/11/2012, 14:50