... behavior of trehalase depending on the nature of the activation stress (Fig 5B) This shift might argue against the participation of a unique set of interactions involving association of Ntp1p ... oligonucleotide TAF-3 (CTACGGCGGCCGCCCGAGC TAGAATTCATCGA, which hybridizes at the 3¢ end of tps1+ ORF and incorporates a NotI site placed immediately upstream of the TAA stop codon) The 0.7 kb ... the regulation of Ntp1p activity under stress relies on the existence of some kind of interaction between Ntp1p and Tps1p, or other elements, that may be lost under the conditions of the in vitro...
Ngày tải lên: 08/03/2014, 23:20
... binding of GA to the pocket of c-CD occurs in the aqueous solution, accompanying dispersion of the self-association of GA DLS analysis Fig 1H NMR spectra (500 MHz) of GA in the absence or presence of ... correlate with the binding affinity between GA and the receptor 6158 The thermodynamic parameters obtained are in the range of those of other interactions with c-CD [15] The interaction of GA with ... binding is 6155 Interaction of gymnemic acid with cyclodextrins Y Izutani et al Fig Typical ITC profiles of the GA binding to CDs A 2.2 mM solution of GA was injected 16 times in increments of 10 lL...
Ngày tải lên: 16/03/2014, 14:20
Báo cáo khoa học: Interaction of caspase-3 with the cyclic GMP binding cyclic GMP specific phosphodiesterase (PDE5a1) potx
... ApaI-Koz-PDE5A1FOR (AAG GGC CCG CCA CCA TGG AGA GGG CCG GCC CCG GCT) and XbaI-PDE5A1REV (GCT TCT AGA CTC AGT TCC GCT TGG TCT GGC TGC TTT CAC), digesting the product and the vector with ApaI and XbaI (Promega, ... that inactivation of PDE5A1 by caspase-3 might occur via removal of key regions which constitute part of the wall of the catalytic site of PDE5A1 We also suggest a possible interaction between ... removal of the C-terminal tail containing Q807 and F810 by caspase-3 affects the architecture of the catalytic site, and in particular interaction with Q765 Ó FEBS 2003 Interaction of caspase-3 with...
Ngày tải lên: 17/03/2014, 09:20
Báo cáo khoa học: A spectroscopic study of the interaction of isoflavones with human serum albumin pdf
... complex structure to explore the accommodation of genistein and to generate a 3D model of the ternary complex of HSA–warfarin–genistein Results Interaction of isoflavones with human serum albumin genistein ... Fluorescence quenching studies with genistein Interaction of genistein with HSA has been monitored following the quenching of relative fluorescence intensity of HSA Quenching of fluorescence by genistein ... presence of electrostatic interactions apart from the hydrophobic interactions The blue shift of daidzein bound protein fluorescence (Fig 6) is indicative of the role of hydrophobic interactions...
Ngày tải lên: 23/03/2014, 11:20
Báo cáo khoa học: Interaction of selenium compounds with zinc finger proteins involved in DNA repair pdf
... activity, (b) modulate XPA–DNA interactions, and (c) release zinc from XPAzf with equal or stronger efficiency than MT The release of zinc also occurred at high ratios of GSH/GSSG, indicating that ... [34] Determination of the metal content of MT by complete zinc release after oxidation with 10 mM H2O2 and ICP-MS revealed 6.4 zinc atoms per molecule of MT and negligible amounts of cadmium and ... representative outcome of the experiments is shown in Fig 4, derived after a 30 preincubation of XPA with selenocystine In the absence of XPA, selenocystine did not affect the migration of free oligonucleotide...
Ngày tải lên: 30/03/2014, 15:20
Báo cáo Y học: Tryptophan fluorescence study of the interaction of penetratin peptides with model membranes pdf
... aim of this study was to gain better insight into the mode of interaction of the penetratin peptide with lipid bilayers and to investigate the role of the Trp residues and the lipids in this interaction ... interaction of the WT-penetratin and the two W48F- and W56F-variants, with sonicated lipid vesicles, consisting either of zwitterionic phosphatidylcholine (PtdCho) or of a mixture of PtdCho with ... was accompanied by at least a twofold decrease of the uorescence intensity and a decrease of the mean Trp lifetime, in contrast with the behaviour of other peptides [17] The three lifetimes of...
Ngày tải lên: 31/03/2014, 23:20
Báo cáo sinh học: " Modulation of macrophage functions by sheeppox virus provides clues to understand interaction of the virus with host immune system" docx
... Isolation of sheep pox virus from naturally infected sheep with a history of previous vaccination with sheep pox virus (SPV) vaccine In Proceedings of the tenth Conference 5–7 November 1996 Faculty of ... mice successfully vaccinated with SPPV displayed significant increases in IL-12 levels at and days post vaccination as compared to unvaccinated mice IL-12 was examined at that time as it Page of ... A2-A0/A1-A0 A2 is the absorption of cultures with PHAP; A1 is the absorption of cultures without mitogen; A0 is absorption of the blank (culture medium only) Analyses of IL-12 and SOD from cultured...
Ngày tải lên: 18/06/2014, 22:20
báo cáo hóa học:" Modulation of macrophage functions by sheeppox virus provides clues to understand interaction of the virus with host immune system" doc
... Isolation of sheep pox virus from naturally infected sheep with a history of previous vaccination with sheep pox virus (SPV) vaccine In Proceedings of the tenth Conference 5–7 November 1996 Faculty of ... mice successfully vaccinated with SPPV displayed significant increases in IL-12 levels at and days post vaccination as compared to unvaccinated mice IL-12 was examined at that time as it Page of ... A2-A0/A1-A0 A2 is the absorption of cultures with PHAP; A1 is the absorption of cultures without mitogen; A0 is absorption of the blank (culture medium only) Analyses of IL-12 and SOD from cultured...
Ngày tải lên: 20/06/2014, 04:20
báo cáo khoa học: "Interaction of silver nanoparticles with HIV-1" pdf
... of the foamy carbon matrix For these reasons, and based upon our previous work regarding interactions of noble metal nanoparticles with biomolecules[20], we decided to study the interaction of ... properties of nanoparticles are strongly dependent upon their interactions with capping agent molecules[21] Indeed, the surface chemistry of the nanoparticles can modify their interactions with external ... observed read shift is a consequence of both nanoparticles of larger size and the presence of decahedral nanoparticles with pentagonal cross sections Interaction with HIV-1 High angle annular dark...
Ngày tải lên: 11/08/2014, 00:22
báo cáo khoa học: " Interaction of silver nanoparticles with Tacaribe virus" pot
... polysaccharide-coated 25 nm Ag-NPs (Fig 1) Page of Ag-NP interactions with TCRV Prior to determining the effect of Ag-NPs on TCRV infection, we wanted to conclude whether or not there are direct interactions ... f) with b, d, and f being zoomed-in images of the white squares of a, b, and c Images g and h depict virus and the Ag-NPs localizing within the same cell, and i and j depict the interaction of ... of Ag-NPs could be that they are inferring with the zinc (Zn)-finger motif of the virus It has been previously demonstrated that disulfide-based Page of compounds are capable of interacting with...
Ngày tải lên: 11/08/2014, 00:22
báo cáo khoa học: " A compatible interaction of Alternaria brassicicola with Arabidopsis thaliana ecotype DiG: evidence for a specific transcriptional signature" pdf
... TCGTCTTTGTAGCTCTTGTAGGTG CGATTGTGCACCAGCCTCATTGGTT CGTTGTGGCTCTTTACAAACAACAAAAC CGGTGGTACTCCTCCTGGACCCACCGGC GACAACAATGCGGTCGTCAAGG ATGGCAAATATCTCCAGTATTCACA GCTAAGTTTGCTTCCATCATCACCCTT TGCAGCTCGCATAAGCGTTGTGACTGGTA ... AT5G44200 GGCGTCCTGAGACAGCGATGGAG GAAGGATGTGAACTGGCCTCTTG GTATGCGACGCCCTCAAGGATG GCTGATCTCAGGTCATCCATCTG GGAAAACTGCAGAGCTAAAGGTGG GACCACAACGAGAGTATCTCCGTC GTGAGAGAAGGACTAGCCTACGGTAC GATGAAAACCGCTCTTGACAAATG ... CGGCTTCTCACCGGAATATTCTATCG TCACCACAACAGCAGAGCGGG GGCATCAAGAGCGCGACTGTT TTGTGGCTTTTGTTTCGTCCTG CAGGCCTGAGAAGAGCTTGATCCAG GTAAGGGTCCATGTTTGAAGCTG CCTTGAGACTCTCTGTAGTATTCACC GATTGAGCTTCTTCTGCTGAGCATC CCAAGCTGATACACTTCCTCTGC...
Ngày tải lên: 12/08/2014, 03:20
Báo cáo y học: "Highly specific inhibition of leukaemia virus membrane fusion by interaction of peptide antagonists with a conserved region of the coiled coil of envelope" potx
... recurring theme in the interaction of the C-terminal helix of the trimer -of- hairpins with the coiled coil of viral fusion proteins is the interaction of non-polar side chains with deep pockets on ... coupled with a high level of sequence conservation within the heptad repeat region and within the LHR suggests that the model is likely to be a reasonably accurate representation of the interaction ... trimer -of- hairpins Moreover, many of the conserved amino acids of the LHR are located on the face of the LHR that interacts with the grooves on the coiled coil By examining the location of substituted...
Ngày tải lên: 13/08/2014, 05:21
Investigation of the interaction of antimicrobial peptides with lipids and lipid membranes 1
... Titration of micelles with fluorophore 4.3.1.2 Disaggregation of FITC-LPS with a detergent 4.3.2 Calculation of titrating a solution of aggregates with a fluorescent probe 4.3.3 Determination of aggregation ... Titration of 100 nM V4-TMR with increasing concentrations of LPS 89 Figure 5.5 Comparison of ACFs of V4-TMR and complexes of V4-TMR with LPS, lipid A and PC 91 Figure 5.6 Comparison of V4-TMR ... Figure 4.6 Titration of C12E9 and LPS solutions with R18 73 Figure 4.7 Titration of 10 and 20 nM of R18 with increasing concentrations of LPS (0.25-5 µM) 74 Figure 4.8 Dissolution of FITC-LPS micelles...
Ngày tải lên: 14/09/2015, 21:54
Investigation of the interaction of antimicrobial peptides with lipids and lipid membranes 3
... between these two cases The cross-section profile of DPPG monolayer with the presence of 50 nM V4 also displayed obvious protrusion profile with the peak height of 1.430 nm When the peptide concentration ... then added to prepare a solution with V4 concentration of 0.2mM Required volume of POPG or POPC was mixed with V4 to form lipid/V4 mixture with V4 percentage of 0%, 5%, 10%, 20%, 33%, 50% and ... chloroform and DPPG was dissolved in the mixture of chloroform and methanol (v/v=3:1) with a final lipid concentration of 0.2 mM All the studied antimicrobial peptides were dissolved in water with...
Ngày tải lên: 14/09/2015, 23:32
Investigation of the interaction of antimicrobial peptides with lipids and lipid membranes 2
... The mixture of V4-TMR and lipid A or PC was incubated for at least hours for FCS experiments Interaction of V4-TMR with SUVs The procedure is similar to that of interaction of V4- TMR with LPS The ... of V4-TMR to SUVs of pure lipids The interaction of V4-TMR (200 nM) with POPG, POPC, POPE, DPPG, DPPC and DPPE was compared by studying mixtures of V4-TMR with SUVs in PBS The concentration of ... particle exhibited an F2 of 4.2 % and an increase in the fluorescence yield compared to TMR of Q2/Q1 of 3.21 90 Fig 5.5 Comparison of ACFs of V4-TMR and the complexes of V4-TMR with LPS, lipid A and...
Ngày tải lên: 14/09/2015, 23:32
Interaction of burkholderia pseudomallei with cells of the immune system
... maintenance of cell lines 40 Bacterial strains 40 Infection of T cells with live bacteria strains 40 Costimulation of bacteria-infected T cells with TCR stimulus 41 Costimulation of T cells with bacteria ... medium at a density of x 106 cells/ml Cells were infected with B pseudomallei strain KHW at multiplicity of infection (MOI) of 5:1 or 30:1 Cells were incubated with bacteria at 37°C with % CO2 Two ... minutes with % formaldehyde Cells were washed times with PBS and pulsed with 200 pg/ml of SIINFEKL OVA peptide for hour B3Z T cells were infected with bacteria for hours at various MOIs according...
Ngày tải lên: 08/11/2015, 16:31
Interaction of polymeric nanoparticles with a model cell membrane a langmuir film balance technique
... pharmacokinetic/pharmacodynamic profiles An acceptable route of administration in consideration of the anticipated dose, dosing frequency and chronicity of the disease Access to, and retention of, the pharmacological ... monolayer can be correlated to their interaction with biomembranes [16] The influence of the physicochemical properties of Introduction nanoparticles on their interaction with cells can also be investigated ... surface properties of the particles The objective of this work is to investigate the influence of the physico-chemical properties of polymeric nanoparticles on their interactions with cells Emphasis...
Ngày tải lên: 08/11/2015, 16:31
Tài liệu Báo cáo khoa học: Insights into the interaction of human arginase II with substrate and manganese ions by site-directed mutagenesis and kinetic studies Alteration of substrate specificity by replacement of Asn149 with Asp docx
... invariant Km value upon mutation of these residues agree with the currently accepted mechanism for the arginase reaction, which considers the 4541 Interaction of arginase II with substrate and manganese ... the active sites of this enzyme and arginase I In spite of the relatively low agmatinase activity of the Asn149Asp variant, it is clear that the interactions of arginase II with l-arginine and ... blue staining of purified enzymes Metal-free species of purified enzymes were obtained by incubation for h at 25 °C with 25 mm EDTA and m 4545 ´ V Lopez et al Interaction of arginase II with substrate...
Ngày tải lên: 20/02/2014, 02:21
Tài liệu Báo cáo khoa học: Interaction of the small heat shock protein with molecular mass 25 kDa (hsp25) with actin doc
... polymerization of intact actin and aggregation of heated actin Interaction of HSP25 with intact actin Fig Effect of heating on the kinetics of polymerization (A) and saltinduced increase of the light ... parameter A of actin was close to 2.4 Increase of the time of heating at 43 °C leading to decrease of parameter A up to 2.2–2.3 was accompanied by further decrease of the initial rate of polymerization ... peptide bands with apparent molecular mass of 29, 31 and 33 kDa were accumulated during the early stages of trypsinolysis of actin heated at 43 °C (Fig 4A) During the late stages of trypsinolysis,...
Ngày tải lên: 20/02/2014, 23:20
Tài liệu Báo cáo Y học: Prediction of protein–protein interaction sites in heterocomplexes with neural networks ppt
... regions of interaction, in agreement with the contacts with GrpE and the results obtained from experiments with mutants The contact regions predicted with our method and the implicit model of interaction ... the accuracy It can be speculated that in cases of false predictions with high values of reliability index, by comparing with the presently available data base of interacting complexes the accuracy ... similar to that of the residue distribution both in the contact and in the whole surface The dependence of the accuracy values and of the fraction of total residues with a given accuracy on the...
Ngày tải lên: 21/02/2014, 15:20