interaction between an ion and a water quadrupole

Contributions of Various Noncovalent Bonds to the Interaction between an Amide and S-Containing Molecules

Contributions of Various Noncovalent Bonds to the Interaction between an Amide and S-Containing Molecules

... Wiley-VCH Verlag GmbH & Co KGaA, Weinheim ChemPhysChem 2012, 13, 3535 3541 Interaction between an Amide and S-Containing Molecules b and c indicates that the benefit of forming CHãããS and SHãããp ... the contrary, the NHãããS H-bond that occurs in a makes for a stronger interaction than any involving CH3SH The structure that contains an NHãããS H-bond for NMA/CH3SH is somewhat weaker, and represents ... contribution involving charge transfer from the S lone pairs to the CO p* antibonding orbital Altogether, these interactions add up to a total stabilization energy of more than kcal mol1, the largest...

Ngày tải lên: 16/12/2012, 15:21

7 450 0
Báo cáo lâm nghiệp:"An examination of the interaction between climate, soil and leaf area index in a Quercus ilex ecosystem" ppt

Báo cáo lâm nghiệp:"An examination of the interaction between climate, soil and leaf area index in a Quercus ilex ecosystem" ppt

... understand how the water and carbon balances behave as a function of water availability and LAI; and (3) define how the balance between LAI and environmental conditions can be expressed MATERIALS AND ... explore a wide range of water availability, and by estimates obtained for ecosystems in the Mediterranean area with different LAIs In a Mediterranean shrubland, Rambal [53] found an annual transpiration ... C Hoff and S Rambal fall and leaf quantity [33, 43] Important then are the timing of rainfall and drought events, the quantity of rainfall, the storage capacity of the soil and quantity and type...

Ngày tải lên: 08/08/2014, 01:21

9 487 0
A study on an example of non-verbal interaction between the presenter and audience for English majored students at the School of Foreign Language

A study on an example of non-verbal interaction between the presenter and audience for English majored students at the School of Foreign Language

... audience analysis, organization, stage fright, visual aids, eye contact and facial expressions, body language, voice, Q &A period, and language use in presentation Students can all know these factors ... pp.19-26 Al-Issa, A (200 7a) English language teaching at the College of Law-Muscat, Sultanate of Oman: Analyzing needs and understanding problems Asian Journal of English Language Teaching, 17, ... can make use of such factors in delivering a presentation and know each factor’s advantages as well as disadvantages Followings are the implications, limitations of the study and some suggestions...

Ngày tải lên: 19/03/2015, 10:37

50 454 2
Báo cáo khoa học: Interaction between Lim15/Dmc1 and the homologue of the large subunit of CAF-1 – a molecular link between recombination and chromatin assembly during meiosis pot

Báo cáo khoa học: Interaction between Lim15/Dmc1 and the homologue of the large subunit of CAF-1 – a molecular link between recombination and chromatin assembly during meiosis pot

... Acknowledgements We thank Montserrat Anguera, Jennifer Erwin and Janice Ahn for critical reading of the manuscript, and all members of Sakaguchi Laboratory for help and discussions S H N is a research fellow ... Koshiyama A, Hamada FN, Namekawa SH, Iwabata K, Sugawara H, Sakamoto A, Ishizaki T & Sakaguchi K (2006) Sumoylation of a meiosis-specific RecA homolog, Lim15/Dmc1, via interaction with the small ... Hamada F, Namekawa S, Kasai N, Nara T, Kimura S, Sugawara F & Sakaguchi K (2002) Proliferating cell nuclear antigen from a basidiomycete, Coprinus cinereus Alternative truncation and expression...

Ngày tải lên: 07/03/2014, 05:20

10 487 0
Báo cáo y học: "A structural constraint for functional interaction between N-terminal and C-terminal domains in simian immunodeficiency virus capsid proteins" ppsx

Báo cáo y học: "A structural constraint for functional interaction between N-terminal and C-terminal domains in simian immunodeficiency virus capsid proteins" ppsx

... vitro MY and HS performed structure modeling analyses HY and MK examined viral genome sequences NI and TM analyzed the data and wrote the paper All authors read and approved the final manuscript ... equally at the 205th aa in Gag; 340 V/M, V and M were detected equally at the 340th aa in Gag a presenting a structural constraint for functional interaction between SIV CA NTD and CTD HIV and ... Science, and Technology, a grant-in-aid from the Japan Society for the Promotion of Science, grants-in-aid from the Ministry of Health, Labor, and Welfare, and a grant from Takeda Science Foundation...

Ngày tải lên: 13/08/2014, 01:20

10 365 0
EUROPEAN COMPETITION LAW ANNUAL 2005: The Interaction between Competition Law and Intellectual Property Law doc

EUROPEAN COMPETITION LAW ANNUAL 2005: The Interaction between Competition Law and Intellectual Property Law doc

... Complementary Strategies and Complementary Assets, 28 R and D Management 263; Arora A. , Fosfuri A and Gambardella A (2003): Markets for Technology and Corporate Strategy, in Granstrand O., ed., supra ... General of the Legal Service and Competition Directorate at the European Commission, Brussels Fels Allan, Dean of the The Australia and New Zealand School of Government (ANZSOG), Melbourne, Australia ... Property Law Edited by Claus-Dieter Ehlermann and Isabela Atanasiu OXFORD PORTLAND OREGON 2007 (A) Ehlermann 06 Prelims 2/3/07 09:38 Page iv Published in North America (US and Canada) by Hart Publishing...

Ngày tải lên: 16/03/2014, 12:20

768 845 1
Báo cáo khoa học: The starch-binding capacity of the noncatalytic SBD2 region and the interaction between the N- and C-terminal domains are involved in the modulation of the activity of starch synthase III fromArabidopsis thaliana pdf

Báo cáo khoa học: The starch-binding capacity of the noncatalytic SBD2 region and the interaction between the N- and C-terminal domains are involved in the modulation of the activity of starch synthase III fromArabidopsis thaliana pdf

... transformed with pNAL1 and used for expression analysis Truncated proteins were generated using the following primers: 2.1up, AAACATATGCTATATTACAATAAAA GG; 2.2up, AAACATATGTTATCTATCGTTGTAAAGC; ... 2.3up, AAACATATGCTTGTTCCTCAAAAACTTCC; 3.3rv, AAACTCGAGGACCTTAGCCGTAGTCTTCAC; 3.2rv, AAACTCGAGTTTTCCATTCAAAACCGTG Construction of site directed mutants The mutated proteins D123W36 6A, D123Y39 4A and ... FEBS 437 SBD regulation of starch synthase III activity Nahuel Z Wayllace et al 123W36 6A, CCAAAGAGCGGAAATTGGGCGTTCGCT GAAGTTG; 123Y39 4A, CTAAAGGAGCGTTTCTG GCTGACAATAATGGTTAC The mutated sequences...

Ngày tải lên: 22/03/2014, 21:20

13 457 0
visual recognition of activities, gestures, facial expressions and speech- an introduction and a perspective in motion-based recognition

visual recognition of activities, gestures, facial expressions and speech- an introduction and a perspective in motion-based recognition

... computations, and therefore parameterization of trajectories is necessary A trajectory can be parameterized in several ways for instance ; S curve, speed and direction, velocities v and v , and spatiotemporal ... Cipolla et al 7] used a rigid motion of a triangular region on a glove to control the rotation and scaling of an image of a model Darrell and Pentland 9] used model views, which are automatically ... grasps An intensity image is used for the identi cation and localization of the ngers using curvature analysis, and a range image is used for 3-D cylindrical tting of the ngers Davis and Shah...

Ngày tải lên: 24/04/2014, 13:40

14 292 0
Analyse criterias when there is an m and a and take a company that you know as an example to analyse your criterias analyses

Analyse criterias when there is an m and a and take a company that you know as an example to analyse your criterias analyses

... Microsoft and their partners • Nokia brings proven capability and talent in critical areas • Ongoing share growth and the synergies across marketing, branding, and advertising Nokia • Be the best path ... organizations or companies join together to become a new business • In an acquisition: one business buys a second and generally smaller company Goals Increase in top line revenue Expand in a declining ... Information Curious, open to new ideas Quite ambitious Geography Nokia is selling its headquarters in Finland for 170 Microsoft Corporation is an American multinational corporation million euros...

Ngày tải lên: 08/05/2014, 17:42

17 724 8
Báo cáo hóa học: " Review Article Reversible Watermarking Techniques: An Overview and a Classification" doc

Báo cáo hóa học: " Review Article Reversible Watermarking Techniques: An Overview and a Classification" doc

... vectors are forward transformed and then divided into the groups S1 , S2 , and S3 S1 , and S2 are modified in Sw and Sw (watermarked) and the pixel values of the original image I(i, j, and k) are ... (triplets and quads) have almost the same performance with all images (except Lena at PSNR greater than 30 dB) From the results above and from the comparison with Celik and Tian, the spatial quad-based ... proposed algorithm can conceal more information than Tian’s and Thodi’s methods, while the performances of Alattar scheme are similar In general, the proposed scheme is better than Alattar at low and...

Ngày tải lên: 21/06/2014, 17:20

19 255 0
Báo cáo hóa học: "Single-photon Transistors Based on the Interaction of an Emitter and Surface Plasmons" docx

Báo cáo hóa học: "Single-photon Transistors Based on the Interaction of an Emitter and Surface Plasmons" docx

... transistor As a summary, we have presented a scheme for a singlephoton transistor, where the ‘gate’ field propagates along a nanotip and the ‘signal’ field travels along a nanowire perpendicular ... furthermore, a CNOT gate which is a key part of an optical quantum computer [3] is available This system may also be a promising candidate for realizing electromagnetically induced transparency-based ... can, first, let one photon change the state of an emitter, and then such change will significantly affect the propagation of another one According to this principle a single-photon transistor may...

Ngày tải lên: 22/06/2014, 01:20

4 326 0
Báo cáo hóa học: "Interaction between High-Level and Low-Level Image Analysis for Semantic Video Object Extraction" docx

Báo cáo hóa học: "Interaction between High-Level and Low-Level Image Analysis for Semantic Video Object Extraction" docx

... data very compactly 3.4 Semantic and region partition interaction The region and the semantic partitions can be improved through interaction with one another The interaction is realized by allowing ... understand and to manipulate both by computers and by humans than the traditional unstructured representation The visual data representation we use in this work mimics the human visual system and ... New York, NY, USA, 1967 [13] A Cavallaro and T Ebrahimi, “Video object extraction based on adaptive background and statistical change detection,” in Visual Communications and Image Processing...

Ngày tải lên: 23/06/2014, 01:20

12 360 0
Báo cáo toán học: " Permutations which are the union of an increasing and a decreasing subsequence" doc

Báo cáo toán học: " Permutations which are the union of an increasing and a decreasing subsequence" doc

... α and a decreasing subsequence β that have a common point In such a permutation (σ, say) α is a maximal increasing subsequence and β is a maximal decreasing the electronic journal of combinatorics ... A Therefore S ∈ B and, similarly, T ∈ B However, S T and S < T and this is a contradiction Therefore all red points belong to B By a similar argument all yellow points belong to B also, and all ... permutation has the form shown in Figure In this figure the vertical and horizontal lines have the obvious separation meaning; for example, if R and W are red and white points we would have R W and W...

Ngày tải lên: 07/08/2014, 06:22

13 348 0
báo cáo khoa học: " Science, institutional archives and open access: an overview and a pilot survey on the Italian cancer research institutions" ppt

báo cáo khoa học: " Science, institutional archives and open access: an overview and a pilot survey on the Italian cancer research institutions" ppt

... Italian biomedical publications Repositories contain metadata, say “meta information” (data about data) They can be defined as structured data which describe the characteristics of a data set and ... “Metadata allow us to describe and classify research information in a systematic way, and as such they are indispensable for searching and finding academic publications and other results of research.” ... coordination and support action aims to establish an integrated model for a Europe-wide cancer information and policy exchange portal that will provide a functional exchange system for accurate...

Ngày tải lên: 10/08/2014, 10:20

14 297 0
Báo cáo y học: " Journey to the heart of macrophages: the delicate relationship between HIV-1 and a multifaceted cell type" ppt

Báo cáo y học: " Journey to the heart of macrophages: the delicate relationship between HIV-1 and a multifaceted cell type" ppt

... efficient viral replication upon differentiation into macrophages and interaction with T cells Virology 2006, 344:267-276 Mantovani A, Sica A, Sozzani S, Allavena P, Vecchi A, Locati M: The chemokine ... constraints or color figure charges • Immediate publication on acceptance • Inclusion in PubMed, CAS, Scopus and Google Scholar Acknowledgements AC acknowledges the CNRS, INSERM, ANRS and Sidaction ... forms of macrophage activation and polarization Trends Immunol 2004, 25:677-686 Peluso R, Haase A, Stowring L, Edwards M, Ventura P: A Trojan Horse mechanism for the spread of visna virus in...

Ngày tải lên: 12/08/2014, 23:23

2 287 0
Báo cáo y học: "Network security and data integrity in academia: an assessment and a proposal for large-scale archiving" potx

Báo cáo y học: "Network security and data integrity in academia: an assessment and a proposal for large-scale archiving" potx

... of the attack and any data loss is still being investigated, a geophysics graduate student at University of California, Berkeley had all her files and many emails erased by this hacker In another ... central hosting; and provide central authentication, enabling distributed collaborations Finally, and most importantly, one can never fully prevent successful attacks and it must be assumed that ... suggested that a large-scale backup system be set up to archive academia’s digital data and to ensure its integrity for posterity It is important to note that most of the data and information about...

Ngày tải lên: 14/08/2014, 14:22

4 281 0
Interaction between nonlinear parametric and forced oscillations

Interaction between nonlinear parametric and forced oscillations

... fundamental parametric resonance J of Sound and Vib ratio n (1988), 120 (1), 63-93 Nguyen Van D in h Interaction between parametric and forced oscillations in fundamental resonance Journal of Mechanics, ... classical nonlinear oscilla T h e appearance of a delay parameter makes the systems under examination nge ciUialit-atively and quantitatively See, for example, curves and of Figure or the case ... moves up and the two lower branches and aretied and then separated, as branches and 5, see Fig for h = 0.01 and Fig forh = 0.027 F ig F ig s S t a b i l i t y o f s t a t io n a r y o sc illa tio...

Ngày tải lên: 08/04/2015, 15:28

21 258 0
Interaction between the forced and parametric excitation with different degrees of smallness

Interaction between the forced and parametric excitation with different degrees of smallness

... s tra ig h t lin e and the reson ance c u rv e r iv a t iv e d w / d a o is p o sitiv e lla t io n if M is > 0, > So, th is p o in t co rre sp o n d s to a sta b le state an d to an u n stab ... if M fro m a regio n w > to a region w < O n the c o n tra ry , if < 0, then the p o in t of in te rse ctio n ponding to a sta b le sta te of o s c illa tio n if M < and to an u n sta b le one ... Iig c = A + — - D = — ,H = hw , -P a l, ( ) ve the following equations for stationary values do, 00 satisfying the relations: dZ - = d dt = dt 0; ' / = „ = J y 0, ( 2 ) v ' / = H a + D a s in...

Ngày tải lên: 08/04/2015, 15:28

7 244 1
Interaction between legionella pneumophila and biofilm forming organism pseudomonas aeruginosa

Interaction between legionella pneumophila and biofilm forming organism pseudomonas aeruginosa

... biofilm may result in the multiplication of legionellae Commensal bacteria such as Flavobacterium breve, an environmental Pseudomonas, Alcaligenes and Acinetobacter and blue-green algae (Cyanobacterium ... transmission of infection is the generation of an infective aerosol from a Legionella contaminated water source (Winn, 1999) Aspiration of contaminated potable water is another probable mechanism ... bacteria or co-inoculum of the bacteria and amoeba A passage through Acanthamoeba castellanii was found to reactivate viable but non-culturable (VBNC) Legionella into culturable state (Steinert et al.,...

Ngày tải lên: 08/11/2015, 16:31

195 144 0
w