inside a movie clip the flower graphic instance follows a motion path
Dragging a Movie Clip Instance within a Boundary
Ngày tải lên :
28/10/2013, 19:15
... the basketball_mc instance becomes draggable The true parameter value used in this action causes the center of the basketball_mc movie clip instance to be locked to the vertical and horizontal ... dragged The advantage of this technique is that it allows you to drag multiple movie clip instances simultaneously In contrast, the startDrag() action allows only one movie clip instance at a ... boundary coordinates is to draw a simple box on the stage Resize it and position it in the area that will serve as the boundary in the scene Select the box and then open the Info panel Using the...
- 7
- 221
- 0
Dragging and Dropping Movie Clip Instances
Ngày tải lên :
28/10/2013, 19:15
... checks whether the movie clip instance was dragged onto the canvas If so, the function creates a duplicate of that instance on top of the canvas and then places the original instance back at its ... remember for the next exercise After it's created, the duplicate is sent to the same frame as the original instance so that the same icon that was dragged appears on the canvas The next action is ... actually been dropped on the canvas If the mouse pointer is over canvas_mc, a copy of the movie clip instance that's dragged and dropped is created using duplicateMovieClip() The name given to the...
- 6
- 245
- 0
Tài liệu Creating Movie Clip Instances Dynamically docx
Ngày tải lên :
26/01/2014, 11:20
... contain only one movie clip instance at a time If you duplicate a movie clip instance into a depth that already contains another movie clip instance, you will destroy the movie clip instance that's ... ball_mc); Using attachMovie() Using attachMovie(), you can actually pull a movie clip out of the library dynamically and attach an instance of it to any timeline currently available on the stage—in ... attaches the paint movie clip in the library to the _root.wall_mc movie clip instance The newly attached movie is given an instance name of paint2_mc and placed on a depth of 10 Because an attached movie...
- 15
- 168
- 0
Tài liệu Targeting Movie Clip Instances pptx
Ngày tải lên :
26/01/2014, 11:20
... In addition, because the spaceship_mc movie clip instance is now in the same position relative to the alien_mc movie clip instance as the root timeline was before, the spaceship_mc instance can ... is attached to the instance named Kathy_mc, the first action uses a relative target path to target the myKid_mc instance within Kathy_mc This action sets the rotation property of this instance ... percent each time the mouse is moved The last action uses an absolute target path to target the myKid_mc instance inside the Ashlie_mc instance Each time the mouse is moved, the instance will...
- 4
- 240
- 0
Tài liệu Targeting Movie Clip Instances on Levels ppt
Ngày tải lên :
26/01/2014, 11:20
... because most projects are set up so that a dynamic element on one timeline can be used by another For example, a variable may be named myVariable Suppose that variable exists in a movie clip instance ... the colors_mc movie clip instance Its timeline has similar color boxes and frame labels to those of the colors_mc movie clip instance This movie clip instance will display the current color applied ... named alphaAmount_txt You will use it in two ways: to display the current transparency of the colors_mc movie clip instance on Level 0, and to display the amount of transparency that will be applied...
- 8
- 328
- 0
Tài liệu Z-Sorting Movie Clip Instances pdf
Ngày tải lên :
26/01/2014, 12:20
... window1_mc and window2_mc are instances of the same movie clip they just have different instance names The ActionScript in this step is used to direct these instances to the frames labeled color and admin, ... depths above it filled For example, imagine that you had a movie clip with an instance name of holder_mc and you attached a movie clip at depth 2050 inside it This ActionScript: var nextDepth:Number ... that instance becomes draggable and a reference of the instance is passed to the swap() function When the button in window2_mc is clicked, that instance becomes draggable and a reference of that...
- 7
- 240
- 0
A New Map of Hollywood: The Production and Distribution of American Motion Pictures pot
Ngày tải lên :
07/03/2014, 15:20
... to Canada, Australia, Britain and Mexico, with Canada receiving 81% of the total The Monitor Company (1999) estimates that the total dollar loss to the US as a result of economic runaways was ... competitive advantages in the form of increasing returns to scale and scope and positive agglomeration economies Such advantages are fundamental in maintaining the status of the region as the leading ... various advantages at the satellite location, c2 falls below c1 at higher levels Among these advantages we may count relatively low wages, low rental rates for sound stages and equipment, advantageous...
- 19
- 703
- 0
Faculty of The Arts Graphic Design pptx
Ngày tải lên :
08/03/2014, 16:20
... Contact details The Departmental Administrator Tel: +27 12 382 6145 E-mail: artsinfo@tut.ac.za www.tut.ac.za Dance | Drama | Fashion Design | Film & TV Production | Fine & Applied Arts | Graphic ... using observation and imagination, to build a visual vocabulary as source material for communication design Dance | Drama | Fashion Design | Film & TV Production | Fine & Applied Arts | Graphic Design ... far afield as Europe, America and Australasia, where they have competed very successfully within their discipline Career profile The prospective student should have an interest in and understanding...
- 5
- 219
- 0
movie review the mirror has two faces
Ngày tải lên :
21/03/2014, 22:09
... mother He Late at night Greg calls Rose to the window by screaming and yelling Roses name against the wishes of the doorman to Hannah's apartment The doorman attempts to stop Greg however his attempts ... comes to the window and Greg explains that he has changed his beliefs about a no sex marriage Rose accepts his proposal and the two are off to Greg's apartment to consummate the marriage ... domineering mother stating she is not home or available unknown to Rose Greg concentrates on his decision and changes his mind about a no sex marriage returns home early in an effort to win Rose back from...
- 2
- 328
- 0
Báo cáo khoa học: A biophysical view of the interplay between mechanical forces and signaling pathways during transendothelial cell migration doc
Ngày tải lên :
22/03/2014, 21:20
... mitogen-activated protein kinase cascade, and proteolysis leading to apoptosis Activation of the NF-jB pathway leads to recruitment and activation of IjB kinase kinase; the phosphorylation and activation ... Concluding remarks The mechanical state of the endothelium is influenced by many external factors, both chemical and mechanical Because the mechanical state of the endothelium is probably an important regulator ... These treatments will also facilitate or hinder leukocyte transmigration, respectively, and therefore the spatial organization of the F-actin network as a physical barrier is a crucial regulator...
- 14
- 513
- 0
Báo cáo khoa học: A novel pathway for sequential transformation of 7-dehydrocholesterol and expression of the P450scc system in mammalian skin pptx
Ngày tải lên :
23/03/2014, 13:20
... Primer location Amplified band (bp) P553 P554 P557 P558 GTGATTCTCTGCTAGATGTTG GGCACTCGAACAGTCATATTG ATTAAGGAGCTTCGGGAGATG CTCTTATACCCAATGCTGCTG First pair GCCTTTGAGTCCATCACTAAC CCAGTGTCTTGGCAGGAATC ... standard had been confirmed by NMR analysis The standard was further purified by RP-HPLC and stored at )70 °C Materials and methods Enzymatic assays Biological materials Tissue Human skin and placenta ... of amplified message DNA ladder is marked M (A) HaCaT keratinocytes (lane 1); normal epidermal keratinocytes (lane 2); C1–4 squamous cell carcinoma (lane 3); dermal fibroblasts (lane 4); epidermal...
- 11
- 475
- 0
Báo cáo Y học: Modeling the three-dimensional structure of H+-ATPase of Neurospora crassa Proposal for a proton pathway from the analysis of internal cavities pptx
Ngày tải lên :
23/03/2014, 21:20
... aspartate (Asp378 in PMA1_NEUCR), several cavities are also seen at the same position in ATC1_RABIT (data not shown) Aside from mutations directed against a small stretch of amino acids adjacent to the ... translocation step (b) Internal polar cavities in the cytoplasmic domain The cavities identified in this domain trace a clear path that starts in the center of the b-strands forming the Rossman ... investigated (a) Internal polar cavities in the transmembrane domain In the transmembrane domain, the first small cavity (cavity 7) is located between Val289 and Ile293 in the N-terminal end of M3, and...
- 13
- 514
- 0
Báo cáo khoa học: A new pathway encompassing calpain 3 and its newly identified substrate cardiac ankyrin repeat protein is involved in the regulation of the nuclear factor-jB pathway in skeletal muscle pdf
Ngày tải lên :
29/03/2014, 21:20
... CGCCATGGCAATGATGGTACTGAAAGTAGAGG CGGCCCGGGAACTGATTAAGAGTCTGTCG GAGCCATGGAACAACGGAAAAGCGAGAAAC CGGCCCGGGAACTGATTAAGAGTCTGTCG CACCATGATGGTACTGAGAG GAATGTAGCTATGCGAGAGTTC CACCATGGCCGAGTTCAGAAATGGAGAAG ... CACCATGGCCGAGTTCAGAAATGGAGAAG GAATGTAGCTATGCGAGAGTTC CACCATGCTGAAGACACTTCCGGCCAACAG GAATGTAGCTATGCGAGAGTTC CACCATGCTGAAAGCTGCGCTGGAGAAC GAATGTAGCTATGCGAGAGTTC CACCATGACCAAAGTTCCAGTTGTGAAGG GAATGTAGCTATGCGAGAGTTC CACCATGATGGTACTGAGAG ... primer mC3.F ACAACAATCAGCTGGTTTTCACC mC3.P TGCCAAGCTCCATGGCTCCTATGAAG mC3.R CAAAAAACTCTGTCACCCCTCC mCARP.F CTTGAATCCACAGCCATCCA mCARP.P CATGTCGTGGAGGAAACGCAGATGTC mCARP.R TGGCACTGATTTTGGCTCCT...
- 16
- 462
- 0
ON THE MARK GRAPHIC DESIGN pdf
Ngày tải lên :
31/03/2014, 15:20
... Later that day, Maciek called me with a strange story about Tsunami At that stage, nobody knew anything about the scale of the disaster We arrived late back in Colombo to learn from Maciek about ... amateur photos and articles helped create a very personal account of life for families living and working abroad A newsletter for expatriates and their families Tsunami Following the earthquake ... and subsequent Tsunami in South Asia there have been many reports on those affected and the relief work carried out by various Global Aid Agencies Ela Kwiatkowski who has been accompanying Maciek...
- 13
- 250
- 0
scientific american - 1998 03 - inside a virtual human
Ngày tải lên :
12/05/2014, 15:34
... Also: Digitally duplicating actor Alan Alda 70 The Caiman Trade Peter Brazaitis, Myrna E Watanabe and George Amato Can you tell a “genuine alligator” handbag from one made of contraband caiman skin? ... high-quality, legal American alligator skin, the sides are made from cheaply produced caiman leather And the latter may have come from the largely contraband trade in skins Traffic-USA, a branch of the World ... the alligators (Alligatoridae) The last includes the American alligator, its near relative the diminutive Chinese alligator and the caiman Caimans inhabit the freshwater rivers, streams, lakes,...
- 85
- 574
- 0
bài 7 giới thiệu về movie clip – làm việc với video – xuất bản đoạn phim
Ngày tải lên :
23/05/2014, 17:27
... động đoạn phim Flash Player Slide - Giới thiệu Movie Clip - Làm việc với video - Xuất đoạn phim SYMBOL MOVIE CLIP Movie clip lồng Flash đặt symbol Movie Clip vào symbol Movie Clip khác Tạo linh ... SYMBOL MOVIE CLIP SYMBOL MOVIE CLIP Là kiểu symbol Flash Mọi instance symbol liên kết với symbol gốc bảng Library Mỗi symbol Movie Clip ch a Timeline riêng, độc lập với Timeline Có thể đặt symbol Movie ... s a, lưu giữ symbol Movie Clip Được chuyển đổi từ movie clip khác cách sử dụng lệnh Modify > Convert to Symbol Ví dụ minh h a: Chọn toàn symbol movie clip Airplane Body, Propellers, Landing Gear...
- 50
- 355
- 0
Báo cáo hóa học: "An Artificial Intelligence Approach for Modeling and Prediction of Water Diffusion Inside a Carbon Nanotube'''' potx
Ngày tải lên :
21/06/2014, 20:20
... reported that the ANFIS systems trained on transformed data sets achieve better performance and faster convergence in general There are many transformation procedures that can be applied to a data set ... take care of overtraining In a sense, the so-called ‘‘overtraining’’ term indicates that a given ANFIS adapts itself too well to the training data set in such a way that further improvement based ... usually the total number of fitting parameters in the ANFIS is more than the number of pairs in the training data set The root mean squared error (RMSE) was used in order to assess the accuracy of the...
- 5
- 424
- 0