in the pink— a sign of corrosion

... this was going on at the dam, a rustling of branches and splashing of water turned the watchers’ attention up-stream Another beaver came in sight, and then another, each partly floating and partly ... nourishment, they were then dragged out again, and floated down to be used in the repair of the dam The other passage, especially adapted to quick exit in case of danger from the way of the roof, was about ... of water against the dam He was apparently heading straight up for the inlet of the pond, on a path which would take him within about twenty-five or thirty yards of the main beaver-house on the...

Ngày tải lên: 06/03/2014, 13:20

Ngày tải lên: 13/08/2014, 11:22

... increasing expertise, laparoscopy can be equally effective with all of the other advantages of a minimal access approach Hence, laparoscopy is now increasingly being employed for removal of ingested ... [10,11]; an intramural width of small intestine of cm or less is considered abnormal An abdominal CT scan is of great help in diagnosing and detecting the etiology of intestinal obstruction in 73–95% ... abdomen showing thebowel 'double Plain radiograph offew dilated loops ofpresence of ain the left Plain radiograph of the abdomen showing the metallic foreign body in the right lower quadrant, the presence...

Ngày tải lên: 11/08/2014, 21:22

... literature involving building and maintaining brand The chapter will also highlight the importance of branding in the marketplace 2.2 What is a Brand? There are many definitions of “brand” Following ... What is the soul of the brand? What are the fundamental beliefs and values that drive the brand? What are the competencies of the organization behind the brand? What does the organization behind ... • • The size and scope of the market; The segment in the market; The players in the market and their positions; The trends in all these areas 10 Market Analysis Market Analysis Market definition...

Ngày tải lên: 13/04/2013, 10:29

... Priorities and hazards for Economies  Variable levels of activity and management capability  Ships’ ballast water and hull fouling are the most important vectors  International shipping, aquaculture ... a role in liaising with IMO, FAO, NACA to enhance the effectiveness of existing instruments within APEC  Institutional arrangements for managing the marine environment is fragmented in most ... Framework  Conclusions, including the results of the November 2001 Workshop Management Framework - Introd uced Marine Pests Management capabilities and approaches  APEC and the MRCWG have a...

Ngày tải lên: 28/10/2013, 11:15

... TGGGGAGGACTTTTATGCTGT CTTTTGTGTAGGTGGGATTCG CTGAGGTTACAGACAACTGTTC CCTTTGACATCGCAAGTGGATCA TTGAGGTGACAGACAATTGCCT TCTTTGACTTCTCAAACTGATCG GCGGCCGCCACCATGCATCATCACCATCAC CATGTCAGCCGTTTTGAACAC GCGGCCGCCACCATGCATCATCACCATCAC ... RPE6 5a- His-Fwd NA TGCARRAAYATHTTYTCCAG AYRAAYTCRWRBCCYTTCCA GCGGCCGCCACCATGGTCAGCCGTTTTGAACAC GATATCTTATGGTTTGTACATCCCATGGAAAG GCGGCCGCCACCATGGTCAGCCGTCTTGAACAC AAGCTTCTAAGGTTTGTAGATGCCGTGGAG TGGGGAGGACTTTTATGCTGT ... iron-dependent Characterization of the kinetic parameters of the enzymatic activity of zebrafish RPE65c To determine the steady-state kinetics of the enzymatic activity of zebrafish RPE65c, the assay conditions...

Ngày tải lên: 14/02/2014, 14:20

... treating physicians and an incorrect initial diagnosis of TB is associated with the potential risk of delay in the institution of ATT and there by facilitates silent spread of the disease.1 The current ... with ageing and hence must be kept in mind during the diagnostic evaluation of elderly patients.11 Several findings of the current study are in accordance with the results of this meta-analysis In ... spontaneously The study was cleared by the ethics committee of the Institute Informed consent was taken for each subject Statistical Analysis Quantitative and qualitative data are expressed as median [inter-quartile...

Ngày tải lên: 15/02/2014, 13:20

... States This vaccine was transferred from a strain that was maintained at the University of Montreal (Montreal, Canada) Vaccine Efficacy Reported rates of the protective efficacy of BCG vaccines ... regarding the risks and benefits associated with both BCG vaccination and TB preventive therapy They should be informed about a) the variable data regarding the efficacy of BCG vaccination, b) the ... National Association of State Public Health Veterinarians Keith A Clark, D.V.M., Ph.D Texas Department of Health Austin, TX National Vaccine Program Anthony Robbins, M.D Office of the Assistant...

Ngày tải lên: 15/02/2014, 13:20

... addition to making use of the information obtained from the OSCE participating States Albania, Armenia, Austria, Azerbaijan, Belarus, Bosnia and Herzegovina, Bulgaria, Canada, Croatia, Cyprus, ... participating States”, “make it their aim to facilitate the freer and wider dissemination of information of all kinds” and “encourage cooperation in the field of information and the exchange of ... For example see Article 263 of the Armenian Criminal Code, Article 242 of the Criminal Code of Azerbaijan, and Article 343 of the Criminal Code (introduced into the Criminal Code by Law of the...

Ngày tải lên: 18/02/2014, 00:20

... considered as follows The role and importance of the aspartate in the catalytic triad is not fully understood because several serine proteases not have an aspartate as the catalytic apparatus M NaCl ... side-chain of His210 increased with the decrease in size of the side-chain at residue 169 (Table and Fig 3A) However, the ASAs of Asp113 and His57 remained constant when the side-chain at residue ... side-chain of His210 On the other hand, a small side-chain at position 169, typically W169V and W16 9A, deviates from the original position In the structural deviation, the solvent ASA of the side-chain...

Ngày tải lên: 21/02/2014, 03:20

... Undesirables Unfits The khamsin Assembling at Moascar Final preparations Train to Alexandria The "Themistocles" The menace of submarines Through the Mediterranean Malta Approaching Marseilles ... grouped around the fortifications near Helles and the villages of Krithia, Kurija Dere, Biyuk Anafarta, and Anafarta Sagir On the side nearer Asia, Maidos, Galata, and Gallipoli boasted the status of ... have especially to thank Captain E A E Andrewartha of the Australian Staff Corps The publication of the Nominal Rolls of Members of the Battalion has been made possible largely through the assistance...

Ngày tải lên: 21/02/2014, 08:20

... a Ph.D in mathemat16 There is a grand tradition in mathematics of not leaving a trail of corn so that the reader may determine how the mathematical material was discovered or developed Instead, ... reviews of it that have appeared, is but one symptom of the ongoing battle The idea of “proof” certainly appears in many aspects of life other than mathematics In the courtroom, a lawyer (either ... applied in a variety of ways, in a vast panorama of disciplines And the applications are many and varied Other disciplines often like to reduce their theories to mathematics because it gives the...

Ngày tải lên: 21/02/2014, 09:20

Ngày tải lên: 21/02/2014, 13:20

... is advocating the rights of nations like Pakistan, Afghanistan, Saudi Arabia, Syria, Iran, and, yes, Iraq; and, rather than labeling them as evil, treating them with reason and decency A great ... well-being of their nation Since at least Calvin Coolidge, there was nothing new in acting against the interests of the common people in order to aggrandize the “leader.” Ronald Reagan continued ... another national Republican icon in the dumbing down during those years She appeared before newspaper and magazine and television reporters again and again to blame all the nation’s ills on the...

Ngày tải lên: 06/03/2014, 06:21

... to concanavalin A (data not shown), ¨ indicating that N-linked glycosylation may account for the increased mass In the absence of b-mercaptoethanol, proSpatzle- 1A migrated to a position around ... gene In the clade including Spatzle-1, the branch lengths are noticeably longer and ¨ the bootstrap values are lower than in the other clades containing Spatzle-2 to Spatzle-6, indicating a lower ... and thereby initiates a cytoplasmic signaling pathway, resulting in the release of a rel family transcription factor Dorsal from the inhibitor protein Cactus to activate genes involved in dorsal–...

Ngày tải lên: 06/03/2014, 09:22

... signal change and the accompanying conformational change in the canonical EF-hand are probably relayed to the SAM domain via the paired ‘hidden’ EF-hand, resulting in the oligomerization of STIM1 ... Ca2+-coordinating residues in positions and of the EF-hand motif significantly compromised the metal-binding capability of the engineered protein, indicating that the metal binding of CD2.STIM1.EF ... cooperativity of Ca2+ binding to EF-hand protein domains Our laboratory has developed a grafting approach to probe the site-specific Ca2+-binding affinities and metal-binding properties of CaM [14] and...

Ngày tải lên: 07/03/2014, 00:20

Ngày tải lên: 07/03/2014, 02:20

... between A- and B-chains In WT thrombin, the A- chain assumes an overall boomerang-like shape interacting with the B-chain surface opposite to the active site [17] Stabilization within the A- chain and ... thrombins The change in pKa value of the catalytic His residue in the mutant thrombin implies that the deletion of Lys9 allosterically affects the conformational state of relevant domains of the catalytic ... steady-state amidase activity and binding of the high-affinity inhibitor a- NAPAP showed pKa values of the catalytic His57 higher in DK9 mutant than in WT thrombin Application of the Brønsted theory...

Ngày tải lên: 07/03/2014, 12:20

... 42  Another finding of the survey is the opinions of asked accountants and managers about the practice of four initiative methods of the application of managerial accounting in Techcombank The ... have an effect on competitive advantages of an organization when taking part in the international marketplace 2.2 Overview of the innovation of management accounting 2.2.1 Definition of management ... have that focus on the innovative management accounting practices to eliminate the redundant accounting practices and encourage a more dynamic and initiative approach to managerial accounting For...

Ngày tải lên: 13/03/2014, 14:20

... that the PX domain of p47phox binds intramolecularly to the SH3 domain in the same protein, and that this intramolecular interaction suppresses the lipid-binding activity of the PX domain in the ... revealed that the GT ⁄ AG rule was maintained in all cases (data not shown) The deduced protein primary structure of mouse and human fad49 The ORF of fad49 encodes a putative protein of 910 amino acids ... domains, suggesting that the PX domain could bind to an SH3 domain of FAD49 To test whether the PX domain could interact with an SH3 domain in FAD49, we performed in vitro binding assays using...

Ngày tải lên: 16/03/2014, 04:20