identi cation and extraction of a genomic sequence between two markers
Tài liệu Báo cáo Y học: Identification and characterization of a mammalian 14-kDa phosphohistidine phosphatase pdf
... traced by its absorbance at 315 nm, appeared as a peak at 0.33 M MDEA and was essentially stable in this buffer at +4 °C for at least months The phosphate content of the The standard assay of the phosphohistidine ... a nanospray interface (Micromass, Manchester, UK) All MS data were processed and analysed with MASSLYNX software programs RNA isolation and molecular cloning of human phosphohistidine phosphatase ... Dr Ake Engstrom at the Peptide Synthesis and Analysis Laboratory ¨ of the Department of Medical Biochemistry and Microbiology, Uppsala University The SP6 primer 5¢-ATT TAG GTG ACA CTA TAG-3¢ and...
- 8
- 666
- 0
Báo cáo khoa học: Identification and characterization of a nuclear receptor subfamily I member in the Platyhelminth Schistosoma mansoni (SmNR1) pot
... ampli cation with TOPO 2.1-SmNR1 as a template (forward primer: 5¢-ATTTCAGAAGTTGAAC AAACACAC-3¢, reverse primer: 5¢-AAGATGGTATT GAAGATGATGGTTGA-3¢), purified from agarose gel using Gel Extraction ... containing three copies of DR2 (ACGCTCACTGGAACACT GGAATGCCCAGTTCTCGTCGCTCACTGGAACACTG GAATGCCCAGTTCTCGTTCGCTCACTGGAACACTG GAATGCCTCTAG) upstream of the thymidine-kinase promoter of reporter plasmid ... Journal compilation ª 2006 FEBS 401 S mansoni NR1 W Wu et al DR1: 5¢-CCGTAAGGTCACAGGTCACTCG-3¢, DR2: 5¢-CCGTAAGGTCACAAGGTCACTCG-3¢, DR3: 5¢-CCG TAAGGTCACAGAGGTCACTCG-3¢, DR4: 5¢-CCGTAA GGTCACAGGAGGTCACTCG-3¢,...
- 16
- 542
- 0
Báo cáo Y học: Identification and characterization of a new gene from Variovorax paradoxus Iso1 encoding N -acyl-D-amino acid amidohydrolase responsible for D-amino acid production pdf
... ShineDalgarno sequence and the N-D-AAase start codon The sequence upstream of the N-D-AAase gene is: 5¢…AGGACAGACGAATG…3¢ (The Shine-Dalgarno sequence and start codon are in bold) The recombinant ... xylosoxydans ssp xylosoxydans A- 6 N-acylD-glutamate amidohydrolase; Alicaligenes faecalis-DA1: Alcaligenes faecalis DA1 N-acyl–D-amino acid amidohydrolase; V paradoxus Iso1: Variovorax paradoxus ... D-Aminoacylase European Patent 60,950,706 ,A2 22 Kubo, K., Ishikara, T & Fukagawa, Y (1980) Deacetylation of PS-5, a new beta-lactam compound II Separation and puri cation of L-amino acid acylase...
- 11
- 656
- 0
Báo cáo Y học: Identification and characterization of a novel activated RhoB binding protein containing a PDZ domain whose expression is specifically modulated in thyroid cells by cAMP pot
... correlated with a profound redistribution of both actin microfilaments and cytokeratin intermediate filaments, and with the appearance of a marked cytokeratin and actin immunoreactivity at the ... (1977) Analysis of singleand double-stranded nucleic acids on polyacrylamide and agarose gels by using glyoxal and acridine orange Proc Natl Acad Sci USA 74, 4835–4838 Savonet, V., Maenhaut, C., ... N., Madaule, P., Reid, T., Ishizaki, T., Watanabe, G., Kakizuka, A. , Saito, Y., Nakao, K., Jockusch, B.M & Narumiya, S (1997) p140mDia, a mammalian homolog of Drosophila diaphanous, is a target...
- 9
- 394
- 0
Báo cáo khoa học: Identification and characterization of a collagen-induced platelet aggregation inhibitor, triplatin, from salivary glands of the assassin bug, Triatoma infestans ppt
... platelets was calculated on the basis of a standard curve obtained with known numbers of platelets Identi cation and characterization of triplatin Platelet lysis and immunoprecipitation of FcR c-chains ... or absence of 1.0 lM triplatin-1 and analyzed by anti-FcR c-chain (aFcR c-chain) and antiphosphotyrosine (aPY) immunoblotting Identi cation and characterization of triplatin The injured arterial ... effect of triplatin-1 and -2 on platelet aggregation caused by collagen, an inhi- Identi cation and characterization of triplatin bition assay was performed using washed platelets instead of PRP...
- 8
- 408
- 0
Tài liệu Báo cáo Y học: Identification and characterization of the Escherichia coli stress protein UP12, a putative in vivo substrate of GroEL pptx
... deoxyoligonucleotide harboring a HindIII site (5¢-CCCAA GCTTTTAACGCACAACCAGCACC-3¢) as primers with E coli genomic DNA as a template and Taq polymerase (Roche Molecular Biochemicals) Next, the purified ... helper plasmid pKD46 Transformants were incubated h at 37 °C and overnight at room temperature in SOC medium and then plated on Luria–Bertani agar plates containing kanamycin Kanamycin resistant (KmR) ... accumulate at the early stationary phase, and its Ó FEBS 2002 steady-state level increases further during the late stationary phase As a result of this accumulation, the relative amount of UP12 in stationary...
- 9
- 548
- 0
Báo cáo khoa học: Identification and characterization of B¢¢-subunits of protein phosphatase 2 A in Xenopus laevis oocytes and adult tissues Evidence for an independent N-terminal splice variant of PR130 and an extended human PR48 protein pot
... AACGAGgtaggc ATCAAGgtaaga ACACAGgtttga GCAAAGgtaatg GAGAAAgtaagt CTTCAGgtaatt ACCACGgtaggc TTGCAAgtatgc ACCAGGgtaagt AACAAGgtaaga TACCAGgtatga TTGATGgtgaga CAGAAGgtaaca GGAAGGgtgagt 35209 16864 ... 70034 ttacagGTTTCT ctgcagGCTGTG ttttagATTCAA ttgcagGTCTGT ttatagGTTGCT tttcagGATGTG aaccagGTTATT tttcagACCCTA atttagCTTCAT ctttagGGGAAA atctagCATTGA atgtagGCAAAA aatcagGATGTT tttcagCTTTGA gene ... 5¢-GG AATTCAGTGGAAAAACTTTACAT-3¢ for XN73, and the primers 5¢-GGAATTCATGCCGACCACAACCGTT TTAAG-3¢ and 5¢-GGAGACAGTGACAAGTTATCTA GTGCT-3¢ for XPR70 PCR products were resolved on a 1.5% (w/v) agarose...
- 12
- 507
- 0
Báo cáo Y học: Novel fish hypothalamic neuropeptide Cloning of a cDNA encoding the precursor polypeptide and identification and localization of the mature peptide pptx
... Kontinen, V.K., Brandt, A & Pertovaara, A (1999) Neuropeptide FF and modulation of pain Brain Res 848, 191–196 Ibata, Y., Iijima, N., Kataoka, Y., Kakihara, K., Tanaka, M., Hosoya, M & Hinuma, S (2000) ... The poly (A) adenylation signal AGTAAA is underlined the supernatant was passed through a disposable C-18 cartridge column (Mega Bond-Elut; Varian, Harbor, CA, USA) and the retained material eluted ... (5¢-GGTCT AAAGGAAATATGTTC-3¢), followed by dA-tailing of the cDNA with dATP and terminal transferase (Roche Diagnostics) The tailed cDNA was amplified with the oligo(dT)-anchor primer (Roche Diagnostics)...
- 9
- 382
- 0
Báo cáo khoa học: Identification and characterization of oxidized human serum albumin A slight structural change impairs its ligand-binding and antioxidant functions pptx
... suggestions We are grateful to Dr Masaichi-Chang-il Lee, Clinical Care Medicine Division of Pharmacology, Kanagawa Dental College, for valuable advice on ESR analysis We also thank Dr Itsuya Tanabe and ... A, Nagasawa T & Era S (2004) Alteration of redox state of human serum albumin before and after hemodialysis Blood Purif 22, 525–529 10 Tomida M, Ishimaru J, Hayashi T, Nakamura K, Murayama K ... to clarify the pathological consequences of oxidation, we identi ed an exact adduct and position of the modi cation of oxidized HSA from human plasma and characterized its specific functional properties...
- 12
- 479
- 0
Tài liệu Báo cáo khoa học: Identification and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebrafish, Danio rerio docx
... GCTGCCTTTGTTATTTGTAAGCTTCAG GGAAACTTCCTGTCTCATCCAGTG GGAACACACAGAGGGGATGATA CTTCAACACGCACAAAGCAC TGCCACCTTTTCCATCATACA CTGCTTTTCTGGGGACTTCA TGAAGTCCCCAGAAAAGCAG GTGCTTTGTGCGTGTTGAAG TGTATGATGGAAAAGGTGGCA GGAACACACAGAGGGGATGATA ... CCATGTCTGCAGATGGTCGAGG GGACTGACATTGCTCCAGAGC GCTTCAGTGACTCAGAAATTGG GTCCAGAATATTCAGCCTTTCACC CTCCCTCAAACAAACCAGAGTC CACTGGATGAGACAGGAAGTT CTTCTCCAGGACAGTCCAAAGAGTC CTGGATTGAAGCGCCCTCGGTTAATC GCTGCCTTTGTTATTTGTAAGCTTCAG ... dG Adapter dT Adapter primer AGTGAGATGGATACAGGTGCTAAAC TCTGGACCTCAGACATGAACTTACT TGTCAGTCCTCTTTAATGCT AATGGTATCCTGTTTGGCTCAG GGTTGTAATTGTACACGGTAGTC CGGTAGTCAGGAAATCAATGCC CCATGTCTGCAGATGGTCGAGG...
- 20
- 689
- 0
Tài liệu Báo cáo khoa học: Identification and characterization of an R-Smad ortholog (SmSmad1B) from Schistosoma mansoni pdf
... Martins EA, Guimaraes PE, Ojopi EP, Paquola AC, Piazza JP, Nishiyama MY Jr, Kitajima JP, Adamson RE et al (2003) Transcriptome analysis of the acoelomate human parasite Schistosoma mansoni Nat ... snail), cercariae, 3-day-old and 7-day-old cultured schistosomules, 15 day, 21 day, 28 day and 35 day parasites, adult worm pairs, separated adult female and male worms, and eggs cDNA from uninfected ... LacZ filter-lift assay (activation of LacZ reporter); and the b-gal units calculated from the liquid LacZ assay (activation of LacZ reporter) + ⁄ –, weak interactions (yeast growth after days of...
- 19
- 653
- 0
Tài liệu Báo cáo khoa học: Purification and characterization of a sialic acid specific lectin from the hemolymph of the freshwater crab Paratelphusa jacquemontii pdf
... 1) and a summary of puri cation (Table 1) give an overall view on the lectin puri cation Erythrocyte preparation Blood for HA assay was prepared as described by Ravindranath et al [12] Puri cation ... Denmark 47 Kamiya, H & Ogata, K (1982) Hemagglutinins in the acorn barnacle Balanus (Megabalanus roseus): puri cation and characterization Nippon Suisan Gokkaishi 48, 1427 48 Kamiya, H., Muramoto, ... (1985) Puri cation and characterization of an O-acetyl sialic acid specific lectin from a marine crab Cancer antennarius J Biol Chem 260, 8850–8856 13 Kawai, T Kato, A Higashi, H Kato, S & Naiki, M...
- 8
- 616
- 0
Tài liệu Báo cáo khoa học: Identi®cation and properties of type I-signal peptidases of Bacillus amyloliquefaciens doc
... GCAGATCTCTTGGCGTATGATTCACTGAT GGNWSNATGGARCCNGARTTYAAYACNGG TCNGCNGCNGCRTTRTTRTCNCCYTTNGT TTGTGTAAAAGTGATGACATCGCC GTGATCCCGATTATTCTGTGTGTT GGCGATGTCATCACTTTTACACAA AACACACAGAATAATCGGGATCAC GAGAATTCAAAAGAAAGCGGGGAAGAA ... GAGAATTCAAAAGAAAGCGGGGAAGAA CGAGATCTTGTGGACATGGTCCCGTTTC CGGAATTCGCTAATGGGAGGAAATCAC TACAGATCTTTTCGTCTTGCGAATTTC CAGAATTCGTCTAGGAGGAACCACGTT GCGAGATCTTTTTGTCTGACGCATATC CAGCAATTGACCCTTAGGAGTTGGCAT GATGGATCTATGGATGCCGCCAATG ... GTNTTYATNGTYTAYAARGTNGARGG TCNGCRTCNSWNATNACNCCNACNAT GCCAAAACAACGATAAGCACGCC GGATTCATGCTGATTCCTTCGAC ACTTGGCACTACACCGCACCTCATGCG ATTTCGTGATTGGCGACAACCGC GAGAATTCCGGAGGGGGACAGGAATCTTG GCAGATCTCTTGGCGTATGATTCACTGAT...
- 12
- 595
- 0
Tài liệu Báo cáo khoa học: Purification and characterization of a membrane-bound enzyme complex from the sulfate-reducing archaeon Archaeoglobus fulgidus related to heterodisulfide reductase from methanogenic archaea pdf
... overlap by bp) The region 81–65 bp upstream of the start codon of AF499 was identi ed as an archaeal promoter element by sequence analysis The sequence AAAGGTTAATATA shows a high level of identity ... arrow indicates the absorption maximum of the a band at 557 nm absorption maxima at 420 nm (c band), 530 nm (b band) and 557 nm (a band) are characteristic of cytochrome b Heme was extracted from ... gel (lane B2) This behavior is typical of integral membrane proteins The polypeptide with an apparent molecular mass of 53 kDa appears as a double band in unboiled samples (lanes A1 and B1) Identi cation...
- 10
- 564
- 0
Báo cáo khoa học: Identification and characterization of 1-Cys peroxiredoxin from Sulfolobus solfataricus and its involvement in the response to oxidative stress pdf
... reported as normalization A ATG translation start codon The presence of cis-acting regulatory sequences typical of archaeal promoters had been observed These sequences are part of the basal transcriptional ... 134, 25–29 12 Kawakami R, Sakuraba H, Kamohara S, Goda S, Kawarabayasi Y & Ohshima T (2004) Oxidative stress response in an anaerobic hyperthermophilic archaeon: presence of a functional peroxiredoxin ... (22.8 kDa) and the RNAse A (15.6 kDa) were used as molecular weight standards Analytical methods for protein characterization Protein concentration was determined using BSA as the standard [29]...
- 11
- 565
- 0
Báo cáo khóa học: Localization, purification and properties of a tetrathionate hydrolase from Acidithiobacillus caldus pot
... hydrolase, acid phosphatase (periplasmic marker), Glc6P dehydrogenase (cytoplasmic marker) and succinate dehydrogenase (cytoplasmic membrane marker) Puri cation of tetrathionate hydrolase All puri cation ... conditions at temperatures of up to 80 °C (data not shown) The interference of ammonium sulfate with the HPLCassay of tetrathionate was also tested The height of the tetrathionate peak decreased and a ... Differential fractionation and localization of tetrathionate hydrolase Based on studies with whole cells and metabolic inhibitors, tetrathionate hydrolase in A caldus has been suggested to be localized...
- 9
- 609
- 0
Báo cáo khoa học: "Joint Identification and Segmentation of Domain-Specific Dialogue Acts for Conversational Dialogue Systems" doc
... error and the standard deviation The largest average error happens with the data annotated with multiple dialogue acts In that case, the extracted segments have a starting and ending point that ... each annotated with a single dialogue act label, and (3) a classifier trained on this annotated utterancelabel set, which assigns for a given word sequence a dialogue act label with a corresponding ... described as PT4 by Tsoumakas and Katakis (?) In our dataset, our method takes on average about 102ms to process an utterance that was originally labeled with multiple dialogue acts, and 12ms...
- 6
- 354
- 0
Báo cáo khoa học: Purification and properties of a new S-adenosyl-Lmethionine:flavonoid 4¢-O-methyltransferase from carnation (Dianthus caryophyllus L.) pot
... of molecular mass markers are indicated in kDa F 4¢-OMT activity towards the different assayed substrates, transformation products and kinetic analysis The enzyme became inactive when the assayed ... Extraction and puri cation of F 4¢-OMT All the puri cation steps were carried out at °C temperature The enzyme was concentrated at various steps of puri cation using collodion bags with kDa cut-off ... B and eluted with 80 mL of a 0–0.3 M linear gradient of NaCl in buffer B, at a flow rate of 0.4 mLÆmin)1 Fractions containing an F 4¢-OMT activity were pooled, dialyzed and concentrated as above...
- 10
- 624
- 0
Báo cáo khoa học: Identification and characterization of plasma kallikrein–kinin system inhibitors from salivary glands of the blood-sucking insect Triatoma infestans pptx
... inhibitors A B H Isawa et al C Fig SDS PAGE and western blot analysis of a T infestans salivary gland extract and puried recombinant triafestin-1 and triafestin-2 A crude salivary gland extract (lane ... 32 Sun J, Yamaguchi M, Yuda M, Miura K, Takeya H, Hirai M, Matsuoka H, Ando K, Watanabe T, Suzuki K et al (1996) Purication, characterization and cDNA cloning of a novel anticoagulant of the intrinsic ... Herwald et al [11] Assay for the effect of triafestin-1 and triafestin-2 on plasma coagulation and tenase activity The effects of triafestin-1 and triafestin-2 on APTT and PT were assayed as follows...
- 16
- 411
- 0
Báo cáo khoa học: Identification and expression of the first nonmammalian amyloid-b precursor-like protein APLP2 in the amphibian Xenopus laevis ppt
... manufacturer (Clontech, MarathonTM cDNA ampli cation kit) 5¢-RACE was performed using adaptor primer 5¢-CCATCCTAATAC GACTCACTATAGGGC-3¢ and gene specific reverse primer 5¢-CAGCAAGTACGTGGTGGTAATGACGG-3¢ ... guidelines of the Dutch law concerning animal welfare Rapid ampli cation of 5¢ cDNA ends To generate a pool of adaptor-ligated double stranded cDNAs, total Xenopus brain RNA was isolated using a total ... FEBS 2004 Fig Amino acid sequence comparison between the Xenopus and mammalian APLP2 proteins (A) Alignment of the amino acid sequences of Xenopus APLP2 -A/ B, and human, mouse and rat APLP2 proteins...
- 7
- 405
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose