... Wiley and Sons, Inc. 6. Levin, J. R., & Mayer, R. E. (1993). Understanding illustrations in text, in B.K. Britton, A. Woodward, and M. Binkley (Eds.), Learning from Textbooks: Theory and ... Locatis, C. (2002). Instructional design and technology in health care. In R. A. Reiser, and J. V. Dempsey (Eds.), Trends and issues in instructional design and technology (pp.225-238). New Jersey, ... settings for education and training in health could be listed including the schools of pharmacy, health departments, public and private hospitals and clinics, pharmaceutical and biotechnology companies,...
Ngày tải lên: 14/02/2014, 13:20
... 0.1% TFA in water and 20% of 0.1% TFA in 40% acetonitrile. Excitation and emission wavelengths of the fluorescence detector were set at 450 and 525 nm, respectively. FAD and FMN standards were used ... AAAA CTGCAGTCAATGATGATGATGATGATGGGCCTCG TCCTTCAGCG. MfeI and PstI sites were inserted in for- ward and reverse primers, respectively, upstream and down- stream the start and the stop codons, whereas a (His) 6 - coding ... The amplified DNA was digested by MfeI and PstI and ligated into the ampicillin-resistant expression vector pSD80 [43], which was digested by EcoRI and PstI, and introduced by electroporation in...
Ngày tải lên: 19/02/2014, 06:20
Tài liệu Báo cáo khoa học: Long-distance interactions between enhancers and promoters The case of the Abd-B domain of the Drosophila bithorax complex pdf
... homology independent interactions. Trans Genet 139, 815–833. 18 Hendrickson JE & Sakonju S (1995) Cis and trans inter- actions between the iab regulatory regions and abdom- inal-A and Abdominal-B. ... (2005) 32533259 ê 2005 FEBS 3259 L. Sipos and H. Gyurkovics Long-distance interactions in Abd-B REVIEW ARTICLE Long-distance interactions between enhancers and promoters The case of the Abd-B domain ... inactive iab-7 and iab-8 regions (thick dotted figures) loop out. In the next abdominal segment, A7, iab-7 becomes activated and takes over the regulation of Abd-B from iab-6. Long-distance interactions...
Ngày tải lên: 20/02/2014, 01:20
Tài liệu Human Breast Milk: Current Concepts of Immunology and Infectious Diseases pptx
... their interactions with antigen receptors on T- and B-cells. The capability of the adaptive immune response to recognize and react against thou- sands of specific antigens is dependent on T- and B-cell ... marrow, and thymus, where the T- and B-cells are produced and develop. The “secondary” organs include lymph nodes, spleen, and mucosa-associated lymphoid tissue (MALT), where mature T- and B-cells ... contact with fluids, and fomites, etc.) and the immaturity and/ or ineffectiveness of their immune system. Development of immunity and susceptibility of infants and children at different ages to infection...
Ngày tải lên: 22/02/2014, 05:20
Tài liệu Interactions Between Workers and the Technology of Production: Evidence from Professional Baseball doc
... related papers to ours are by Ichino and M aggi (2000) and Mas and Moretti (2006). Ic hino and M aggi (2000) examine shirking behav ior within a large banking firm, and show that a worke r’s shirking ... Reagan and Yankow (2004), Gould, Lavy and Pa serman (2004a and 2004b). 2 3forthefixed-effects a nd first-differences specifications respectively. T h e first column in the bottom pan els of Tables 4 and ... effort and player 2 exerts effort if and on ly if the first task succeeded. 2. Player 1 exerts effort a nd play er 2 exerts effort if and on ly if the fir st task failed. 3. Player 1 e xerts e ffort and...
Ngày tải lên: 22/02/2014, 09:20
THE ALKALOIDS Chemistry and Physiology VOLUME V pptx
... respiratory rate, and blood pressure after 20 mg. of morphine xerc similar in addicts and post-addicts (55). NARCOTICS AND ANALGESICS 37 during withdrawal and must be handled by appropriate ... Denton and Beecher, the pain threshold was determined before and 90 min. after the injection. There is a possibility that the discrepancies between Hardy, Wolff, and Goodell and Denton and ... function as surely and as dramatically as does morphine. Unfortun- ately morphine elicits other reactions, many of them undesirable ones, and 22 HUGO KRUEGER and equations (1 2) and (14),...
Ngày tải lên: 06/03/2014, 14:20
Immunology and Evolution of Infectious Disease potx
... specific recognition and by hiding from host defenses (Reeder and Brown 1996). Full understanding of the forces that have shaped the archival repertoire, switching process, and course of infection ... antigens and the numbers of immune cells that specifically bind to particular antigens. Ithendiscusshow the successes and failures of different parasite antigens within each host determine the rise and ... rate at which new variants arise andspread and the rate at which old variants are lost from the popula- tion. As host individuals age, they become infected by and recover from different antigenic...
Ngày tải lên: 07/03/2014, 05:20
Báo cáo khoa học: Interactions between metals and a-synuclein ) function or artefact? pptx
... nitrative stress and pathological inclusions in Alzheimer’s and Parkin- son’s diseases. Free Radic Biol Med 32, 1264–1275. 48 Lee MK, Stirling W, Xu Y, Xu X, Qui D, Mandir AS, Dawson TM, Copeland NG, ... alpha-synuclein-polyamine complexes elucidates the mechanism and kinetics of induced aggre- gation. EMBO J 23, 2039–2046. D. R. Brown Interactions between metals and a-synuclein FEBS Journal 274 (2007) 3766–3774 ... these Cu–peptide interactions are specific and would occur in vivo. Additionally, Cu-peptide studies are notori- ously misleading because Cu co-ordination changes with large fragments and it is possible...
Ngày tải lên: 07/03/2014, 10:20
Báo cáo khoa học: Identification, subcellular localization and functional interactions of PilMNOWQ and PilA4 involved in transformation competency and pilus biogenesis in the thermophilic bacterium Thermus thermophilus HB27 ppt
... that PilA4 and PilQ are individually essential for transfor- mation and piliation [7,8]. In contrast to PilQ and PilA4, an individual role of PilM, PilN, PilO and PilW in natural transformation and ... form and a 23-kDa form; the last was found to be glycosylated. We demonstrate that PilM, PilN and PilO are located in the inner membrane, whereas PilW, PilQ and PilA4 are located in the inner and ... FEBS 3271 Identification, subcellular localization and functional interactions of PilMNOWQ and PilA4 involved in transformation competency and pilus biogenesis in the thermophilic bacterium Thermus...
Ngày tải lên: 07/03/2014, 12:20
Báo cáo khoa học: Differential interactions of decorin and decorin mutants with type I and type VI collagens pptx
... the interactions between leucine-rich repeats and protein ligands. Nature 374, 1 83–186. 45.Keene,D.R.,Ridgway,C.C.&Iozzo,R.V.(1998)TypeVI microfilaments interact with a sp ecific region of banded ... analysis of interactions between proteoglycans and collagens, the sensograms were corrected by a modification of the method of Roden and Myszka [20]. To correct for changes in refractive index and nonspecific ... different expression and purification procedures. In our expression system transfected 293 cells syn thesize decorin with its normal pre- and propeptide sequences and have expression and secretion rates...
Ngày tải lên: 07/03/2014, 16:20
Morphology and physiology of viruses
... Medical Biology, Microbiology, Virology, and Immunology STRUCTURE, CLASSIFICATION AND PHYSIOLOGY OF VIRUSES Classification by Biological, Chemical, and Physical Properties DNA-Containing ... replication. (2) Size and morphology, including type of symmetry, number of capsomeres, and presence of membranes. (3) Presence of specific enzymes, particularly RNA and DNA polymerases, and neuraminidase ... pneumonia and bronchiolitis, adenovirus pharyngitis, common cold (caused by many viruses). CLASSIFICATION OF VIRUSES (1) Nucleic acid type: RNA or DNA; single-stranded or double- stranded; strategy...
Ngày tải lên: 15/03/2014, 12:59
Viruses STRUCTURE, CLASSIFICATION AND PHYSIOLOGY OF VIRUSES
... cells. viruses attack eukaryotic cells. Viruses and bacteriophages invade cells Viruses and bacteriophages invade cells and use the host cell's machinery to and use the host cell's machinery ... replaced daily. yet only 1.8 billion can be replaced daily. In isolation, viruses and In isolation, viruses and bacteriophages show none of the bacteriophages show none of the expected signs ... lifeless collection of macromolecules a lifeless collection of macromolecules and they do show one of the most and they do show one of the most important signs of life: the ability to important...
Ngày tải lên: 15/03/2014, 13:08
Báo cáo khoa học: Krit 1 interactions with microtubules and membranes are regulated by Rap1 and integrin cytoplasmic domain associated protein-1 doc
... [23]. Rap1 and ICAP-1 regulate Krit1 localization to microtubules and membranes Among the FERM family members, ERM proteins and talin provide a regulated linkage between mem- brane proteins and the ... to and activates b integrins [5]. VAV1 and TIAM1 are localized by Rap1GTP to sites of cell spreading and serve as exchange factors for Rac [6]. ARAP3 is a GTPase-activating protein for RhoA and Arf6 ... and C-termini and that Rap1 and ICAP-1 inhibit Krit1 binding to microtubules. Consistently, YFP-Krit1 localizes on cyan fluorescent protein-labelled microtubules in baby hamster kidney cells and...
Ngày tải lên: 16/03/2014, 05:20
Báo cáo khoa học: Structural and mutational analyses of protein–protein interactions between transthyretin and retinol-binding protein doc
... polyene chain is fully extended and the hydroxyl end group is almost solvent exposed, in the region of the loops that con- nect b-strands A and B, C and D and E and F and surround the entrance of ... hyper-variable regions of Fab: loops 53–56 and 100–103 and the short helix 28–32 of chain H and loops 31–36 and 53–56 of chain L. The interactions, which are mainly polar and comprise several H-bonds, are ... loops formed by b-strands A and B and b-strands G and H. One of the two-fold symmetry axes of the tetramer is coincident with a long channel that transverses the entire molecule and harbors two binding...
Ngày tải lên: 30/03/2014, 02:20
McGraw hill interactions 2 listening and speaking 4th edition
Ngày tải lên: 04/04/2014, 23:52
schaum's outline of human anatomy and physiology - kent m. van de graaff, r. ward rhees
Ngày tải lên: 08/04/2014, 12:37
schaum's outline of human anatomy and physiology - kent m. van de graaff, r. ward rhees
Ngày tải lên: 08/04/2014, 12:40