0

holland joan c 1356 1384 duchess of brittany

C++ Basics - More Flow of Control

C++ Basics - More Flow of Control

Kỹ thuật lập trình

... the action of a branch is too simple to warrant a function call, use multiple statements between braces  A block is a section of code enclosed by braces  Variables declared within a block, are ... inner block and cannot be accessed outside the inner block  The other variable exists only in the outer block and cannot be accessed in the inner block Copyright © 2007 Pearson Education, Inc Publishing ... the next case to be executed!  Omitting a break statement allows the use of multiple case labels for a section of code  case 'A': case 'a': cout
  • 118
  • 440
  • 0
The Duchess of Padua

The Duchess of Padua

Tài liệu khác

... dogs, etc Place: Padua Time: The latter half of the Sixteenth Century Style of Architecture: Italian, Gothic and Romanesque THE SCENES OF THE PLAY ACT I The Market Place of Padua (25 minutes) ACT ... Duke's Palace (36 minutes) ACT III Corridor in the Duke's Palace (29 minutes) ACT IV The Hall of Justice (31 minutes) ACT V The Dungeon (25 minutes) ACT I SCENE The Market Place of Padua at ... to passer-by and doffs his cap.] Pray, sir, is this the market place, and that the church of Santa Croce? [Citizen bows.] I thank you, sir ASCANIO Well? GUIDO Ay! it is here ASCANIO I would it...
  • 11
  • 341
  • 0
The government of Brittany under Henry II

The government of Brittany under Henry II

TOEFL - IELTS - TOEIC

... Thus the `seneschal of Anjou' and the `seneschal of Poitou' became the superior of cer in the administration of each county The appearance of a `seneschal of Rennes' under Duke Conan III represents ... process The seneschal of Rennes under Dukes Conan III and Conan IV was the chief of cer responsible for the ducal domain in the county of Rennes Whether his circumscription was the entire county ... transaction of the bishop of Rennes in his of cial capacity Even in William's case, most of the extant records of his activities (that is, two out of three) were made by the churches which bene®ted...
  • 17
  • 485
  • 0
Tài liệu Báo cáo khoa học: Altered inactivation pathway of factor Va by activated protein C in the presence of heparin doc

Tài liệu Báo cáo khoa học: Altered inactivation pathway of factor Va by activated protein C in the presence of heparin doc

Báo cáo khoa học

... abundance of heparin-like structures on the surface of the vascular bed, and the lack of good estimates of local concentrations of coagulation proteins or reactants during hemostatic reactions, ... Bottom right: molecular surface of FVa domains A1, A2, and A3 color-coded according to electrostatic potentials Preliminary docking of FVa Arg506 into the catalytic cleft of APC suggests that the ... similar inhibitory activity to UFH In contrast, equimolar amounts of pentasaccharide did not influence the inactivation of FVa by APC To relate the inactivation curves of FVa to speci c cleavages in...
  • 13
  • 654
  • 0
Tài liệu C++ Lab 6 Review of Variables, Formatting & Loops docx

Tài liệu C++ Lab 6 Review of Variables, Formatting & Loops docx

Kỹ thuật lập trình

... endl; switch (grade) { case 'A' : cout > one; while (one >0) { cout > two; cout ... First step is to decide which of the variables can be selected as loop control variable If no variables are available to select, you can add new variable - for example, a char variable - and...
  • 7
  • 393
  • 0
Tài liệu The Duchess Of Berry/Charles X potx

Tài liệu The Duchess Of Berry/Charles X potx

Khoa học xã hội

... Chamberlain of France, of the Grand Equerry of France, of the Grand Huntsman of France, and of the Grand Master of Ceremonies of France The Grand Almoner was the Cardinal, Prince of Croy, Archbishop ... forehead of Charles X in the solemnity of his consecration, is the same as that which, since Clovis, has consecrated the French monarchs." The day of the consecration approached The Mayor of Rheims, ... King, Charles X., in 1825, the year of the consecration The civil household of the King comprised six distinct services: those of Grand Almoner of France, of the Grand Master of France, of the...
  • 100
  • 370
  • 0
Tài liệu Báo cáo Y học: Enhancement by a-tocopheryl hemisuccinate of nitric oxide production induced by lypopolysaccharide and interferon-c through the upregulation of protein kinase C in rat vascular smooth muscle cells docx

Tài liệu Báo cáo Y học: Enhancement by a-tocopheryl hemisuccinate of nitric oxide production induced by lypopolysaccharide and interferon-c through the upregulation of protein kinase C in rat vascular smooth muscle cells docx

Báo cáo khoa học

... incubation Ó FEBS 2002 Tocopheryl succinate-enhanced NO production (Eur J Biochem 269) 2369 Fig Enhancements by TS of LPS/IFN-induced NO production (A) and iNOS induction (B) in VSMC The concentrations ... LPS/IFN-induced NO production is caused by enhancement of iNOS protein induction Effects of a-T and its derivatives on the enhancement by TS of LPS/IFN-induced NO production We compared the effects of ... N., Mayne, G .C. , Olejnicka, B., Negre-Salvayre, A., Stı´ cha, M., Coffey, R.J & Weber, C (2001) Induction of cancer cell apoptosis by a-tocopheryl succinate: molecular pathways and structural requirements...
  • 6
  • 494
  • 0
C++ Lab 15 Review of Arrays, Array of Objects and Vector Dr. John Abraham, Professor doc

C++ Lab 15 Review of Arrays, Array of Objects and Vector Dr. John Abraham, Professor doc

Kỹ thuật lập trình

... place random numbers from to 52 in it Once we have the random numbers, we just display the card names in that order string cards[52]={ "CA", "C2 ", "C3 ", "C4 ", "C5 ", "C6 ", "C7 ", "C8 ", "C9 ", "C1 0","CJ","CQ","CK", ... data, the second one to find the difference of each score from the mean and the third one to find store the square of deviation of each score The mean is calculated by adding all valid scores stored ... Read scores from a file into an array Keep track of number of scores entered Find difference of each score from the Mean Square the differences and add the squares find stadard deviation create...
  • 7
  • 416
  • 1
Báo cáo

Báo cáo " Cell suspension culture Panax ginseng C. A. Meyer: Role of plant growth regulators and medium composition on biomass and ginsenoside production " docx

Báo cáo khoa học

... tissue culture process in order to be economically competitive with field cultivation of ginseng A number of physical and chemical factors that could influence secondary metabolite in plant cell cultures ... of the hormone concentration and combination are often effective For ginseng cell growth, 2,4 D is most commomly used in routine culture maintenance [6] But use of this suspected carcinogen often ... Inc., Cary, USA) Results and discussion To understand the culture characteristics of the suspended cells of ginseng in shake flask, the effect of plant growth regulators (2,4-D or IBA or NAA combination...
  • 6
  • 492
  • 0
Beatrice d''''Este, Duchess of Milan, 1475-1497 docx

Beatrice d''''Este, Duchess of Milan, 1475-1497 docx

Cao đẳng - Đại học

... BEATRICE D'ESTE CHAPTER I 13 CHAPTER I The Castello of Ferrara The House of Este Accession of Duke Ercole I. His marriage to Leonora of Aragon Birth of Isabella and Beatrice d'Este Plot of Niccolo ... Maria Regency of Duchess Bona Exile of the Sforza brothers Lodovico at Pisa His invasion of Lombardy and return to Milan Death of Cecco Simonetta Flight of Duchess Bona Lodovico Regent of Milan ... Cook CONTENTS PAGE * CHAPTER I 1471-1480 The Castello of Ferrara The House of Este Accession of Duke Ercole I. His marriage to Leonora of Aragon Birth of Isabella and Beatrice d'Este Plot of Niccolo...
  • 232
  • 332
  • 0
Báo cáo khoa học: Hydroperoxide reduction by thioredoxin-specific glutathione peroxidase isoenzymes of Arabidopsis thaliana potx

Báo cáo khoa học: Hydroperoxide reduction by thioredoxin-specific glutathione peroxidase isoenzymes of Arabidopsis thaliana potx

Báo cáo khoa học

... GGATCCTTTAAGCG GCAAGCAA), AtGPX2 (CATATGGCGGATGAATC TCCAA ⁄ GGATCCTCCTCCTCCTGGTGAT), AtGPX5 (CATATGGGTGCTTCATCATCAT ⁄ GGATCCCTGTG CGTGTTCACAA) and AtGPX6 (CATATGGCAGC AGAGAAGTCTG ⁄ GGATCCAGTTATCCAGATTGAA) ... h2 (CATATGGGA GGAGCTTTATC ⁄ GGATCCGCGTTAACAATGCTCA) and Trx h3 (CATATGGAAGAGAAGCCGCA ⁄ GGATCC AAATCAAGCAGCAGC) proteins were amplified by RTPCR with chimeric primers (in parenthesis) introducing ... GPX2, Cytosol GPX5, ER GPX6, Cytosol ⁄ mit Citrusa Tomatob GPX1, Cytosol GPXle1, Cytosol Sunflowerb GPXha1, Cytosol Yeastc GPX2, Cytosol Chinese cabbaged PHCC-TPx, Cytosol a [6], b [17], c [16],...
  • 9
  • 414
  • 0
Báo cáo khoa học: Detection and characterization of a novel extracellular fungal enzyme that catalyzes the specific and hydrolytic cleavage of lignin guaiacylglycerol b-aryl ether linkages pdf

Báo cáo khoa học: Detection and characterization of a novel extracellular fungal enzyme that catalyzes the specific and hydrolytic cleavage of lignin guaiacylglycerol b-aryl ether linkages pdf

Báo cáo khoa học

... under speci c conditions Analysis of the products of the reaction revealed the presence of guaiacylglycerol (GG) and 4MU (data not shown) Localization of enzymatic activity To confirm the localization ... HP, hyphae fraction; EC, extracellular fraction; CY, cytoplasmic fraction Control, GOU added to mL of VM (B) Assay of b-aryl ether cleavage by the extracellular fraction with a model compound that ... lignin-related compounds, p-hydroxybenzoic acid, gallic acid and vanillic acid, as a sole source of carbon Cell growth and the production of the b-aryl ether cleavage enzyme We cultured 2BW-1...
  • 10
  • 670
  • 0
Báo cáo khoa học: Bovine tryptases cDNA cloning, tissue specific expression and characterization of the lung isoform ppt

Báo cáo khoa học: Bovine tryptases cDNA cloning, tissue specific expression and characterization of the lung isoform ppt

Báo cáo khoa học

... CAGTACGTCCCCCAGGGGCCCtgagcctggtccccaggccgccccctgggtcagcggaggagctggccccca 864 ♦ cagtcccctcaacactgcttccggccgaggaggagaccttcccccaccttccccggccccctgtcccagtgc 936 ccacacctgatgaccccactcctggctgtacccctctcccgctcagctcacccccccgcaggggctgctgac ... CAGTACGTCCCCCAGGGGCCCtgagcctggtccccaggccgccccctggtcagcggaggagctggccccctc 864 Q Y V P Q G P ♦ (245) tgtcccctcagcgctgcttccggcccgaggaggagaccttcccccaccttccctggccccctgcccaatgcc 936 cacccctggctgacccctctctgctgacccctccctgccctgaacccctgccccagccccctccccactagc 1008 tcagggcgctggcaggggctgctgacactcataaaaagcatggagagcag ... 288 CTGCTGCCCATCAGCAGGATCATCCCCCACCCCAACTGCTACAGCGTTAAGAACGGGGCGGACATCGCCCTG 360 CTGGAGCTGGACAAGCTTGTGAATATCTCCTGGCACGTCCAGCCGGTCACCCTGCCCCCTGAGTCGGAGACC 432 TTCCCCCCGGGGACGCAGTGCTGGGTGACGGGCTGGGGCAACGTGGACAATGGAAGGCGCCTGCCGCCCCCA...
  • 11
  • 527
  • 0
Beatrice d''''Este, Duchess of Milan, 1475-1497 doc

Beatrice d''''Este, Duchess of Milan, 1475-1497 doc

Khoa học xã hội

... BEATRICE D'ESTE CHAPTER I 13 CHAPTER I The Castello of Ferrara The House of Este Accession of Duke Ercole I. His marriage to Leonora of Aragon Birth of Isabella and Beatrice d'Este Plot of Niccolo ... Maria Regency of Duchess Bona Exile of the Sforza brothers Lodovico at Pisa His invasion of Lombardy and return to Milan Death of Cecco Simonetta Flight of Duchess Bona Lodovico Regent of Milan ... Cook CONTENTS PAGE * CHAPTER I 1471-1480 The Castello of Ferrara The House of Este Accession of Duke Ercole I. His marriage to Leonora of Aragon Birth of Isabella and Beatrice d'Este Plot of Niccolo...
  • 232
  • 266
  • 0
Báo cáo khoa học: Peroxin Pex21p interacts with the C-terminal noncatalytic domain of yeast seryl-tRNA synthetase and forms a specific ternary complex with tRNASer potx

Báo cáo khoa học: Peroxin Pex21p interacts with the C-terminal noncatalytic domain of yeast seryl-tRNA synthetase and forms a specific ternary complex with tRNASer potx

Báo cáo khoa học

... 20 C- terminal amino acids, whereas in ScSerRSDC13, only the fragment of 13 amino acids (containing seven lysines) was cut off Truncated yeast SerRS constructs were fused to the C- terminal end of ... eukaryotic cytosolic enzymes contain positively charged C- terminal extensions The C- terminal sequence of S cerevisiae and Z mays cytosolic SerRSs is shown in bold letters The sequence truncated ... specificity of the SerRS–Pex21p interaction, the full-length maize (Zea mays cytosolic, Zmc) SerRS (LexA–ZmcSerRS) and its truncated variant (LexA–ZmcSerRSDC26), lacking 26 C- terminal amino acids,...
  • 12
  • 406
  • 0
Báo cáo khoa học: Identification of a copper-repressible C-type heme protein of Methylococcus capsulatus (Bath) A member of a novel group of the bacterial di-heme cytochrome c peroxidase family of proteins docx

Báo cáo khoa học: Identification of a copper-repressible C-type heme protein of Methylococcus capsulatus (Bath) A member of a novel group of the bacterial di-heme cytochrome c peroxidase family of proteins docx

Báo cáo khoa học

... R GGCAACGAGCAAGGTCCGAAG AAGTCGTTGCAATCGGCGTCG GGCAACGAGCAAGGTCCGAAG GACGTCGTGAGTGCCTCCGTG CGACGTGCAGTATTACTTTTCTAGGG AGTATCAAACCGTGCTGGTCTCC Bioinformatic analyses Sequence similarity searches ... described for CCPs and MauGs In conclusion, we have described a novel C- type heme protein located to the cellular surface of the methanotrophic bacterium M capsulatus This protein shares characteristics ... Detection of C- type heme Because of the sequence similarity of SACCP to members of the BCCP family of proteins and the prediction of heme-binding motifs in the primary sequence, it was of interest...
  • 12
  • 392
  • 0
Báo cáo khoa học: Elements of the C-terminal t peptide of acetylcholinesterase that determine amphiphilicity, homomeric and heteromeric associations, secretion and degradation docx

Báo cáo khoa học: Elements of the C-terminal t peptide of acetylcholinesterase that determine amphiphilicity, homomeric and heteromeric associations, secretion and degradation docx

Báo cáo khoa học

... high level of secretion without QN (A 6C, A 6C/ C37S, S1 9C) However, coexpression induced a decrease, of  40%, in the secretion of mutant M2 1C/ C37S, for which complexes could not be detected (not ... the aromatic cluster, had very different effects, depending on the presence of cysteine C3 7 Without C3 7, mutant S1 9C/ C37S produced very low levels of cellular or secreted activity In contrast, ... W17P Transfection of COS cells COS cells were transfected by the DEAE-dextran method, as described previously [24], using lg of DNA encoding the AChE catalytic subunit and lg of DNA encoding QN...
  • 12
  • 309
  • 0
Báo cáo khoa học: Expression and characterization of soluble forms of the extracellular domains of the b, c and e subunits of the human muscle acetylcholine receptor pot

Báo cáo khoa học: Expression and characterization of soluble forms of the extracellular domains of the b, c and e subunits of the human muscle acetylcholine receptor pot

Báo cáo khoa học

... 5¢-GGTGTAGAATTCAAGAACGAGGAACTGCG-3¢ was combined with (a) 5¢-ATAGTTTAGCGGCCG CTTACTTCCGGCGGATGATGAGCGAG-3¢ for e1–219, (b) 5¢-ATAGTTTAGCGGCCGCTTAGTGATGGTGATG GTGATGCTTCCGGCGGATGATGAGCGAG-3¢ for ... 219HIS, (c) 5¢-ATAGTTTAGCGGCCGCTTACGGCTT CCGGCGGATGATGAGCGAG-3¢ for e1–220, or (d) 5¢ATAGTTTAGCGGCCGCTTAGTGATGGTGATGGTGA TGCGGCTTCCGGCG-GATGATGAGCGAG-3¢ for e1– 220HIS (underlined EcoRI and NotI) ... ATTCCGGAACCAGGAGGAGCGC-3¢ was used in all cases, together with the reverse primer (a) 5¢-ATA GTTTAGCGGCCGCTTACTTGCGCTGGATGATGAG CAGG-3¢ for c1 –218, (b) 5¢-ATAGTTTAGCGGCCGC TTAGTGATGGTGATGGTGATGCTTGCGCTGGATG...
  • 12
  • 394
  • 0
Báo cáo khóa học: The C-terminal t peptide of acetylcholinesterase forms an a helix that supports homomeric and heteromeric interactions potx

Báo cáo khóa học: The C-terminal t peptide of acetylcholinesterase forms an a helix that supports homomeric and heteromeric interactions potx

Báo cáo khoa học

... interactions occurring in the concentration range of the critical micellar concentration (cmc) [17] For lysolecithin, the cmc is 20 lM, corresponding to Ri values of 5–6 and 30–40, for peptide concentrations ... interactions of AChET subunits Chemical grafting of synthetic peptides confers hydrophobic properties on water-soluble AChE To characterize the interactions of the t region while excluding possible effects ... were chemically coupled at the surface of a protein However, the t peptide is normally linked to the C- terminus of the catalytic domain of AChET subunits and it contains a cysteine (C3 7) which...
  • 15
  • 333
  • 0
Báo cáo khóa học: NF-jB- and c-Jun-dependent regulation of human cytomegalovirus immediate-early gene ppt

Báo cáo khóa học: NF-jB- and c-Jun-dependent regulation of human cytomegalovirus immediate-early gene ppt

Báo cáo khoa học

... ()740) 5¢-AGGT ACCCAATATTGGCCATTAGCC-3¢; CMV IE ()507) 5¢-CGGTACCTGGCCCGCCTGGCTGAC-3¢; CMV IE ()300) 5¢-TGGTACCATGCCCAGTACATGACCTTA-3¢; CMV IE ()185) 5¢-TGGTACCCGGTTTGACTCACG GGGATT-3¢; CMV IE ()130) ... TCCATGAGCTTCCTGACGTT); 1826(S-2, TCCATGACGTTCCTGAGCTT) and 1826(S-3, TCC ATGAGCTTCCTGAGCTT) The non-CpG-ODN 2041 (CTGGTCTTTCTGGTTTTTTTCTGG) served as a negative control The LPS content of ODNs was ... TCCATGCGTT CCTGACGTT Derivatives of the CpG-ODN 1826 sequence with one or two of the CG sequences reversed to GC (indicated by bold lettering) are as follows: CpG-ODN 1826(S-1, TCCATGAGCTTCCTGACGTT);...
  • 12
  • 330
  • 0

Xem thêm