high and low affinity k uptake

Environmental Adaptations and Stress Tolerance of Plants in the Era of Climate Change pptx

Environmental Adaptations and Stress Tolerance of Plants in the Era of Climate Change pptx

... NH, Rai V, Aoki K, Tanaka Y, Hibino T, Suzuki S, Takano J, Jagendorf AT, Takabe T, Takabe T (2005) Genes for direct methylation of glycine provide high levels of glycine betaine and abiotic-stress ... and uptake of ions, enzymatic and nonenzymatic antioxidant response, maintenance of redox and energetic status, salt inclusion/excretion and genetic control (Flowers and Colmer 2008) Understanding ... CAT, and APX activities, but the formation of superoxide radicals and membrane injury was reduced (Baczek-Kwinta and Ko cielniak 2003) The alleviation of oxidative stress was probably due to a higher...

Ngày tải lên: 14/03/2014, 10:20

532 8K 1
Báo cáo khoa học: Alpha 1,3-fucosyltransferase-VII regulates the signaling molecules of the insulin receptor pathway potx

Báo cáo khoa học: Alpha 1,3-fucosyltransferase-VII regulates the signaling molecules of the insulin receptor pathway potx

... FucTVII-H PKB-T308 PKB-S473 PKB β-actin D 400 350 300 Relative PKB kinase activity Mock β-actin 200 150 100 50 E PKB-T308p Mock PKB-S473p FucTVII-M PDK-1 200 PKN 100 p-PKN β-actin Mock FucTVII-M ... S473 and tyrosine residues) and activity of protein kinase B (PKB; Akt), as well as the phosphorylation of p42 ⁄ 44 mitogen-activated protein kinase (MAPK; ERK-1 ⁄ 2) and MAPK kinase (MEK) before ... phospho-PKB, phospho-PKN, MEK1 ⁄ 2, phosphoMEK1 ⁄ 2, p42 ⁄ 44 MAPK, and mAb against phosphop42 ⁄ 44 MAPK were from Cell Signaling Technology (Beverly, MA) The PKB assay kit was from New England Biolabs...

Ngày tải lên: 16/03/2014, 12:20

13 354 0
Báo cáo hóa học: " Respiratory syncytial virus (RSV) attachment and nonstructural proteins modify the type I interferon response associated with suppressor of cytokine signaling (SOCS) proteins and IFN-stimulated gene-15 (ISG15)" potx

Báo cáo hóa học: " Respiratory syncytial virus (RSV) attachment and nonstructural proteins modify the type I interferon response associated with suppressor of cytokine signaling (SOCS) proteins and IFN-stimulated gene-15 (ISG15)" potx

... expression and catalytic activity IKKε which blocks RSV-induced IRF3 phosphorylation, nuclear translocation and DNA-binding, and leading to inhibition of cytokine gene transcription, mRNA expression and ... Tripp RA, Oshansky C, Alvarez R: Cytokines and respiratory syncytial virus infection Proc Am Thorac Soc 2005, 2(2):147-9 Tsang SL, Leung PC, Leung KK, Yau WL, Hardy MP, Mak NK, Leung KN, Fung MC: ... Methods Viruses and cells Type I IFN-free virus stocks of recombinant RSV strain A2 (6340WT), 6340WT lacking the G protein gene (6340 G), and 6340WT lacking NS1 and NS2 genes (ΔNS1/2) (kind gift of...

Ngày tải lên: 20/06/2014, 01:20

11 435 0
Báo cáo sinh học: "Imp-L2, a putative homolog of vertebrate IGF-binding protein 7, counteracts insulin signaling in Drosophila and is essential for starvation resistance" ppt

Báo cáo sinh học: "Imp-L2, a putative homolog of vertebrate IGF-binding protein 7, counteracts insulin signaling in Drosophila and is essential for starvation resistance" ppt

... invertebrates and the putative human ortholog IGFBP-7 Black and gray boxes indicate amino acid identity and similarity, respectively The triangle marks the premature stop codon in Imp-L2MG2 Asterisks mark ... pBluescript SK+ vector 14 Saltiel AR, Kahn CR: Insulin signalling and the regulation of glucose and lipid metabolism Nature 2001, 414:799-806 Nakae J, Kido Y, Accili D: Distinct and overlapping ... W, Stocker H, Andruss BF, Beckingham K, Hafen E: Autonomous control of cell and organ size by CHICO, a Drosophila homolog of vertebrate IRS1-4 Cell 1999, 97:865-875 Britton JS, Lockwood WK, Li...

Ngày tải lên: 06/08/2014, 18:21

11 345 0
Báo cáo khoa học: "The relationship among acute-phase response proteins, cytokines and hormones in cachectic patients with colon cancer" doc

Báo cáo khoa học: "The relationship among acute-phase response proteins, cytokines and hormones in cachectic patients with colon cancer" doc

... Beecken WD, Kramer W, Jonas D: New molecular mediators in tumorangiogenesis J Cell Mol Med 2000, 4:262-269 Krzystek-Korpacka M, Matusiewicz M, Diakowska D, Grabowski K, Blachut K, Konieczny D, Kustrzeba-Wojcicka ... 148:293-300 Arita Y, Kihara S, Ouchi N, Takahashi M, Maeda K, Miyagawa J, Hotta K, Shimomura I, Nakamura T, Miyaoka K, Kuriyama H, Nishida M, Yamashita S, Okubo K, Matsubara K, Muraguchi M, Ohmoto ... Marks D, Inui A, Asakawa A, Meguid MM: Cancer anorexia-cachexia syndrome: cytokines and neuropeptides Curr Opin Nutr Metab care 2004, 7:427-434 Krzystek-Korpacka M, Matusiewicz M, Diakowska D,...

Ngày tải lên: 09/08/2014, 03:22

6 382 0
báo cáo khoa học: " Cellular localization of ROS and NO in olive reproductive tissues during flower development" doc

báo cáo khoa học: " Cellular localization of ROS and NO in olive reproductive tissues during flower development" doc

... L, McKenna ST, Kunkel JG, Hepler PK: NAD(P)H Oscillates in Pollen Tubes and Is Correlated with Tip Growth Plant Physiol 2006, 142:1-9 10 Potocký M, Jones MA, Bezvoda R, Smirnoff N, Zárský V: ... P06-AGR-01719 (Junta de Andalucía) and BFU2008-00629 (MCI) AZ thanks the CSIC for providing a JAE grant Authors’ contributions JDA and MIR conceived the study JDA and AZ designed and carried out the ... McInnis S, Desikan R, Hancock JT, Hiscock S: Production of reactive oxygen species and reactive nitrogen species by angiosperm stigmas and pollen: potential signallling crosstalk? New Phytol 2006,...

Ngày tải lên: 12/08/2014, 03:21

14 239 0
Protein turnover in tissues effects of food and hormones

Protein turnover in tissues effects of food and hormones

... ảnh  Randomization  Trong bước liệu vector lấy từ bước Freature Extraction tạo băm việc sử dụng khóa K Nêu khóa K không tính giá trị băm ảnh 11 Các bước băm ảnh số  Quantization  K t bước ... khác  Nội dung tin gốc “khó” thể suy từ giá trị hàm băm Nghĩa là: với thông điệp x “dễ” tính z= h(x), lại “khó” tính ngược lại x biết giá trị băm h(x) trang Ứng dụng hàm băm  Ứng dụng chữ k ... số Thay k toàn tài liệu k đại diện tài liệu tạo từ hàm băm  Hàm băm dùng để xác định tính toàn vẹn liệu  Hàm băm dùng để bảo mật số tài liệu đặc biệt ví dụ bảo vệ mật khẩu, bảo vệ khóa mật...

Ngày tải lên: 19/10/2014, 20:02

313 697 0
Contributions of Various Noncovalent Bonds to the Interaction between an Amide and S-Containing Molecules

Contributions of Various Noncovalent Bonds to the Interaction between an Amide and S-Containing Molecules

... Bearpark, J J Heyd, E Brothers, K N Kudin, V N Staroverov, R Kobayashi, J Normand, K Raghavachari, A Rendell, J C Burant, S S Iyengar, J Tomasi, M Cossi, N Rega, J M Millam, M Klene, J E Knox, ... Knox, J B Cross, V Bakken, C Adamo, J Jaramillo, R Gomperts, R E Stratmann, O Yazyev, A J Austin, R Cammi, C Pomelli, J W Ochterski, R L Martin, K Morokuma, V G Zakrzewski, G A Voth, P Salvador, ... H Nakatsuji, M Caricato, X Li, H P Hratchian, A F Izmaylov, J Bloino, G Zheng, J L Sonnenberg, M Hada, M Ehara, K Toyota, R Fukuda, J Hasegawa, M Ishida, T Nakajima, Y Honda, O Kitao, H Nakai,...

Ngày tải lên: 16/12/2012, 15:21

7 450 0
WCDMA UTRAN Interface and Signaling Procedure ISSUE 1.1

WCDMA UTRAN Interface and Signaling Procedure ISSUE 1.1

... of this course, you will be able to:  Understand UTRAN interface and structure  Understand the definitions about UTRAN network elements  Understand UTRAN signaling procedure Copyright © 2008 ... Interface Radio Network Layer Control Plane User Plane Iu UP Protocol Layer RANAP Transport Network Layer Transport Network User Plane Transport Network Control Plane Transport Network User Plane Q.2630.1 ... Interface Radio Network Layer Control Plane User Plane Iu UP Protocol Layer RANAP Transport Network Layer Transport Network User Plane Transport Network Control Plane Transport Network User Plane SCCP...

Ngày tải lên: 23/10/2013, 03:11

84 317 0
Tài liệu Báo cáo khoa học: miRNAs and regulation of cell signaling pptx

Tài liệu Báo cáo khoa học: miRNAs and regulation of cell signaling pptx

... MEK1, CDK4, CDK6 Oct4, SOX2, KLF4 ERa TLX, NFKB1 E2F, Myc ZEB1 ⁄ deltaEF1, SIP1 ⁄ ZEB2 Cyclin D1 ERa c-Myb Dicer Spry1, Spry2, PDCD4, NFIB MeCP2 VAV1 p53, ELK1, ERK-MAPK Oct4 ERa TLX, TLR4-NF-kappaB ... Ichimura et al A Signal MAPKKK 5´ CUAGCCAGAGCCCUUCACUGCCA |||| ||||||| 3´ UUGUUGGUCGAUUCU-GUGACGGU MAP 2K1 3´ UTR hsa-miR-34a ERK-MAPK signaling MEK miR-34a p53 Signaling ERK Spry1, miR-21 SPRY1 3´ ... Wentzel EA, Kent OA, Ramachandran K, Mullendore M, Lee KH, Feldmann G, Yamakuchi M, Ferlito M, Lowenstein CJ et al (2007) Transactivation of miR-34a by p53 broadly influences gene expression and promotes...

Ngày tải lên: 14/02/2014, 19:20

9 684 0
Tài liệu Báo cáo khoa học: Mixed lineage leukemia: roles in gene expression, hormone signaling and mRNA processing docx

Tài liệu Báo cáo khoa học: Mixed lineage leukemia: roles in gene expression, hormone signaling and mRNA processing docx

... K I Ansari and S S Mandal Biochemical functions of MLL MLL Me Me Me H3 K7 9 K7 9 K3 6 K3 6 K2 0 H2A H2A Me Me K4 K4 K9 H3 Activation H2B H2B K2 7 K2 7 Me H4 Silencing Me K1 20 K1 20 H4 Silencing ... gene regulation and mixed lineage leukemia Acknowledgements We thank Imran Hussain, Sahba Kasiri, Bishakha Shrestha, Saoni Mandal and other Mandal lab members for useful discussion and critical ... Dreijerink KM, Mulder KW, Winkler GS, Hoppener JW, Lips CJ & Timmers HT (2006) Menin links estrogen receptor activation to histone H 3K4 trimethylation Cancer Res 66, 4929–4935 14 Wysocka J, Swigut...

Ngày tải lên: 16/02/2014, 14:20

15 607 0
Tài liệu Báo cáo khoa học: Myristoylation of the dual-specificity phosphatase c-JUN N-terminal kinase (JNK) stimulatory phosphatase 1 is necessary for its activation of JNK signaling and apoptosis pdf

Tài liệu Báo cáo khoa học: Myristoylation of the dual-specificity phosphatase c-JUN N-terminal kinase (JNK) stimulatory phosphatase 1 is necessary for its activation of JNK signaling and apoptosis pdf

... Jnk1 and Jnk2 genes are expressed ubiquitously, whereas expression of Jnk3 is largely restricted to brain, heart and testis [4,5] JNK is phosphorylated and activated by the MAPK kinases MKK4 and ... and MKK7 [6,7], with MKK7 primarily responding to cytokines, whereas MKK4 is preferentially activated by environmental stress [5,8] Depending on the stimulus and cellular context, the JNK pathway ... [pii] Yan M, Dai T, Deak JC, Kyriakis JM, Zon LI, Woodgett JR & Templeton DJ (1994) Activation of stress-activated protein kinase by MEKK1 phosphorylation of its activator SEK1 Nature 372, 798–800...

Ngày tải lên: 16/02/2014, 14:20

11 580 0
Tài liệu Báo cáo khoa học: a-Defensins increase lung fibroblast proliferation and collagen synthesis via the b-catenin signaling pathway doc

Tài liệu Báo cáo khoa học: a-Defensins increase lung fibroblast proliferation and collagen synthesis via the b-catenin signaling pathway doc

... MAP kinase, total Akt, and total GSK3b, suggesting that a-defensin-1 and a-defensin-2 cause the activation of p38 MAP kinase and PI 3K ⁄ Akt and increase phosphorylation of GSK3b on Thr390 and ... Ser473-phosphorylated Akt, total Akt, Thr390-phosphorylated GSK3b, Ser9-phosphorylated GSK3b, total GSK3b and GAPDH overnight at °C and then washed with 50 mL of 0.1% Tween-20, 20 mm Tris-HCl (pH 7.5) and 150 ... 286, L514–L520 Yoshioka S, Mukae H, Ishii H, Kakugawa T, Ishimoto H, Sakamoto N, Fujii T, Urata Y, Kondo T, Kubota H et al (2007) Alpha-defensin enhances expression of HSP47 and collagen-1 in human...

Ngày tải lên: 18/02/2014, 06:20

12 602 0
Tài liệu Báo cáo khoa học: DNA methylation-mediated nucleosome dynamics and oncogenic Ras signaling pptx

Tài liệu Báo cáo khoa học: DNA methylation-mediated nucleosome dynamics and oncogenic Ras signaling pptx

... human tumors Biochemistry (Moscow) 70, 576–583 156 Kawamoto K, Okino ST, Place RF, Urakami S, Hirata H, Kikuno N, Kawakami T, Tanaka Y, Pookot D, Chen Z et al (2007) Epigenetic modifications of ... on transcription and histone acetylation Mol Cell Biol 22, 6689–6696 67 Bernstein BE, Kamal M, Lindblad-Toh K, Bekiranov S, Bailey DK, Huebert DJ, McMahon S, Karlsson EK, Kulbokas EJ III, Gingeras ... Development 129, 1983–1993 30 Rhee I, Bachman KE, Park BH, Jair K- W, Yen R-WC, Schuebel KE, Cui H, Feinberg AP, Lengauer C, Kinzier KW et al (2002) DNMT1 and DBNMT3b cooperate to silence genes in...

Ngày tải lên: 18/02/2014, 14:20

19 702 0
Tài liệu Báo cáo khoa học: Osmotic stress sensing and signaling in fishes doc

Tài liệu Báo cáo khoa học: Osmotic stress sensing and signaling in fishes doc

... 163–178 Marshall WS, Ossum CG & Hoffmann EK (2005) Hypotonic shock mediation by p38 MAPK, JNK, PKC, FAK, OSR1 and SPAK in osmosensing chloride secreting cells of killifish opercular epithelium J Exp ... Osmotic regulation of p38 MAPK and JNK (Jun-N-terminal kinase ⁄ stress-activated protein kinase) MAPK phosphorylation was also observed in isolated opercular epithelium of killifish, where chloride ... Integr Comp Physiol 282, R1643–R1653 Ichimura T, Yamamura H, Sasamoto K, Tominaga Y, Taoka M, Kakiuchi K, Shinkawa T, Takahashi N, Shimada S & Isobe T (2005) 14-3-3 proteins modulate the expression...

Ngày tải lên: 18/02/2014, 16:20

9 970 0
Tài liệu Báo cáo khoa học: Osmosensing and signaling in the regulation of mammalian cell function docx

Tài liệu Báo cáo khoa học: Osmosensing and signaling in the regulation of mammalian cell function docx

... exchanger Am J Physiol 284, F829–F839 31 Wu KL, Khan S, Lakhe-Reddy S, Jarad G, Mukherjee A, Obejero-Paz CA, Konieczkowski M, Sedor JR & Osmosensing and signaling in mammalian cell function 32 ... activation [32], induction of the serum- and glucocorticoidinducible kinase Sgk [33], expression of the heat shock protein Hsp70 [34] and cyclooxygenase-2 [35], and a high antioxidant capacity [36] In ... of regulatory volume increase is a key component of apoptosis FEBS Lett 580, 6513–6517 30 Wu KL, Khan S, Lakhe-Reddy S, Wang L, Jarad G, Miller RT, Konieczkowski M, Brown AM, Sedor JR & Schelling...

Ngày tải lên: 18/02/2014, 16:20

5 792 0
Tài liệu Báo cáo khoa học: Dual P2Y12 receptor signaling in thrombin-stimulated platelets – involvement of phosphoinositide 3-kinase b but not c isoform in Ca2+ mobilization and procoagulant activity pdf

Tài liệu Báo cáo khoa học: Dual P2Y12 receptor signaling in thrombin-stimulated platelets – involvement of phosphoinositide 3-kinase b but not c isoform in Ca2+ mobilization and procoagulant activity pdf

... on both phospholipase C and PI3 -K activity PI3-Kb and not PI3-Kc mediates the P2Y12 effect on thrombin-evoked Ca2+ responses In man and mouse, the PI3-Kb (p110b) and PI3-Kc (p110c) isoforms are ... Biochim Biophys Acta 1553, 238– 248 47 Vanschoonbeek K, Feijge MAH, van Kampen RJ, Kenis H, Hemker HC, Giesen PLA & Heemskerk JWM (2004) Initiating and potentiating role of platelets in tissue factor-induced ... understood phosphoinositide 3-kinase (PI3 -K) pathway, which leads to aIIbb3 integrin activation and platelet aggregation [18] We and others have shown that both the PI3-Kb and PI3-Kc isoforms contribute...

Ngày tải lên: 18/02/2014, 16:20

15 565 0
Tài liệu Báo cáo khoa học: The effect of small molecules in modulating the chaperone activity of aB-crystallin against ordered and disordered protein aggregation pdf

Tài liệu Báo cáo khoa học: The effect of small molecules in modulating the chaperone activity of aB-crystallin against ordered and disordered protein aggregation pdf

... Netherlands) at a magnification range of 10 500– 96 000 using an 80 kV excitation voltage Acknowledgements We thank Mr Ying Xiao for performing preliminary experiments involved in this work This work ... Rajaraman K, Ghosh D, Datta S, Trivedi VD & Sukhaswami MB (1998) Structural perturbation of a-crystallin and its chaperone-like activity Int J Biol Macromol 22, 271– 281 McHaourab HS, Dodson EK & Koteiche ... aggregation and protein folding In Protein Folding Handbook: Part II (Buchner J & Kiefhaber T, eds), pp 858–875 Wiley-VCH, Weinheim, Germany Clark JI & Huang QL (1996) Modulation of the chaperone-like...

Ngày tải lên: 18/02/2014, 16:20

13 613 0
Tài liệu Báo cáo khoa học: Compartmentalization and in vivo insulin-induced translocation of the insulin-signaling inhibitor Grb14 in rat liver pptx

Tài liệu Báo cáo khoa học: Compartmentalization and in vivo insulin-induced translocation of the insulin-signaling inhibitor Grb14 in rat liver pptx

... plasma membranes and endosomes are major sites to which IRS-1, phosphoinositide-3-kinase (PI3-kinase) and Akt1 redistribute upon in vivo insulin stimulation, and where IRS-1 and PI3-kinase interact ... PDK-1 [14], IRS-1 [13], and tankyrase [15] The binding of ZIP to Grb14, by recruiting protein kinase Cf, enhances the serine phosphorylation of Grb14 and its inhibitory effect on IR kinase and ... with PDK-1, an upstream kinase that activates Akt in response to insulin, appears to be required for insulin-induced membrane translocation of PDK-1 and Akt activation in transfected HEK cells...

Ngày tải lên: 18/02/2014, 18:20

15 497 0
Tài liệu Báo cáo khoa học: What MAN1 does to the Smads TGFb/BMP signaling and the nuclear envelope Luiza Bengtsson pdf

Tài liệu Báo cáo khoa học: What MAN1 does to the Smads TGFb/BMP signaling and the nuclear envelope Luiza Bengtsson pdf

... was a postdoctoral fellow in Katherine L Wilson’s lab (spring 2005) Warmest thanks to Katherine L Wilson and members of the Wilson lab, especially K E Tifft, M Mansharamani and M S Zastrow for ... the nuclear veil Pediatr Res 57, 8R–15R Holaska JM, Lee KK, Kowalski AK & Wilson KL (2003) Transcriptional repressor germ cell-less (GCL) and barrier to autointegration factor (BAF) compete for ... Wilson KL (2001) LAP2 binds to BAF-DNA complexes: requirement for the LEM domain and modulation by variable regions EMBO J 20, 1754–1764 Lee KK, Haraguchi T, Lee RS, Koujin T, Hiraoka Y & Wilson KL...

Ngày tải lên: 19/02/2014, 02:20

9 704 0
w